Microcebus_murinus Locus Mono:187:SNORA14
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:187:SNORA14
Microcebus_murinus
Mono:187:SNORA14
GeneScaffold_27
SNORA14
1001..1125
2125
GAGTTCAAGACCAGCCTGAGCAAGAGCGAGACCCCATCTCTACTATAAATGGAAAGAAA
TTAGCCAAACAACTAAAAATAAAAAAAAGTTAGCCTGGTGCGGTGGCGCATGCCTGTAGT
CCCAGCTACTTGGGAGGCTGAGGCAGGAGGATTGCTTGAGCCCAGGAGTTTGAGGTTGCT
GTGAGCTAGGCTGACACCACGGCACTCTAGCCCAGGCAACAGAGTGAGACTCTGTCTCAA
AAAAAAAAAAAAAAAGGACTCCTCAGGCCCTACTCAAGAACCTCTTTATTCTTATTTTAG
ATATCATTAACAAGCATAAGCAGCTGATTTCCCAGTTTGAGCAGATTCAGAGCAGTCAAT
TATAAGTGAGGGAGAGACTTCCAAAGGAATGCAGGTACTCTCACAGTGGTGAGTCTCATC
TTGTCCATAAGAAAGGACTAACAGCACCACCAACAAAGAGGCAGGAACCTAAGGGCACAT
AGCCTGGGGTCTCTCCGTGTGGGTACAAGCAGCCTTCCCTACCTCAGTAGCTCCTGAGTA
ATTGTATAATGATGTGATCTGAGTAATCCAGAACAGGCACTCTATGTGGACTCCAGACAG
CTTGGGAATAGTTAACAAATTTTGGAAGCATGCTAATGAATAAGATAGTGAATAATCATA
GAGCTTTAAACCCCTTACATTTTCACAGGCTTTACAAAAGCTAAACTAAGCCTTTTTCTG
CTCCACACATATTTTTGCCACCATCAGTTATACTATACACATGCACACACACACACACAC
ACACATATATGGTGTATACACATATATATCAGTTTTACCACATCTTAGCAGATTCTACTT
CAGATTGTACTAAACTAGTATTTTCTCAACTTCTTTGAAAATGTTCTTGCTTGAAATTGT
TCCATGTTAATTCTTCAGGCACATTAAACTTGGTGTTGACTCCTCAAATAAACAACTGAG
CAGCATAGGTAATGTCTTCAGTCTCATTAGAAGCCAAGTAATTGCATGCATTAGAGCTTT
GTTCTAAATGCTTCCAAGAAATGAGTGAATGCTATAGAAATTGCAGAGGAGTCCAAAGGG
CTGCGCTTCCCCTGTGGCTCAGTCTTATTTCATACCTGTGACATCTTTTAAGAAAGATTT
ACAAGAGGGAAAACTATAAATTAAAAACAGTATATTTTAAAAAGCCAAGGAAATCTTGGC
TCTCCAAAGGAGCAAGGAAACTTAATCTCCTTGATGGCAGAGGAGGCACAGTGAAAGCCA
GGACTTCACCACCACCTGGCTGAACCAGGCTACCCACCACAAGGTGTCAGTGGAGGCCAC
GTGGGCAGCAATAATGAGGTTCCCTTCCCTCTTCTAGCTAGGGATGTCAGCAGAGGCCTA
GTAGGGAGACAGCACCAAGTTGGCACCCTTCTCCCCCACCAGCAGGATGACAGAAAAGGC
CTACTAAAAGAGAAGATCTAAATAAGATTCAGGTCATAAAACATAATAGTCAAAATTCCC
AGGATATGGTGAAAAATTACCCACCATACTAAGAAACAGGAAAATCTCAATTTGAATGAG
AAAAGACAGTCAACAGCTGCCAGACTCAAGATGACACAGATGTTGGAATTATACAAGGTA
TAAAGAGGAACCAGACAGACATCTAAGAACTGAAGGATTCAGTAGCCAAAATAGAAAACT
CAATGGGTGACTGTATGGCAGAATGGAGAAGACAGAGGAAAGAATCCATGAACTTGAAGT
AAGAACAGTAGAAATTACCCAGTCTGAACAACAATGAGAAACTAGACTAAAAAAAACAAA
CAAAAAAAAAACAAACAGAGCAGCAGGGACTTGTGGGACTAATAATGGAAGGTCTAAGTT
TGTTGTCATCGTAGTCCCAGAAGGAGAGGAGAAAGAGGGCAAAGCTGAAAAAATGTTTAA
GAAATAATGGCTGAAAAGTTCCCAAATTTGGCTAAAGACATAAATCTACAGATTCAAGAA
GCTGAATGAACTCCAAACAAGATAAAACCAAAGAAGTCTGCGCCAACAACGTCTTGGTGT
AGATGATAAACTTTCTAGACATTCTAACTATAGAAAAATCTGTTGGAATTGCTCTTTTGG
TCACTGCTTTTTAGCATGTTGCCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved