Microcebus_murinus Locus Mono:203:SNORA11
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:203:SNORA11
Microcebus_murinus
Mono:203:SNORA11
GeneScaffold_735
SNORA11
1001..1129
2129
GTGGCATGCTCATACAATGGAATACTATTCAGCAATGAAAATTAACGAAGTATTGCTAC
ATACAACAACATAGATGATTTTCACAAACTTAAAGTTGTGTGGAAGCCAGATACAAAAGA
ATACATATTACTTGTGTCTTTTCTACAGAAGGAATTGAAACATTAAGAGAAGGAATTCTA
CTTTCATTCCTACCATATGTATAAGTCTTCAATATAAATCTTACTTCATTTTTATTGTGA
TTTTTTTCTGTCAAAAGAGTATTCCAAAAATATATTCTGTAAAATTTTTTGTTAGTGTAA
AGAGATTCTGATGCCCACATAATTTACATGTATACTATAAAGCTAGCTATAGAAAGCTAT
AAATGTTAAGAGTATAAACGTAATTAACTTGTGACAGTTAAAAACAAAAAAGAGGACATA
GTACACAATTCCATTTATAGAAAGTCCAACTACAAACAAAACAAATCTTTGATGGTAGAA
ATAACAATAATGATGGCCGGCTCATGCCTGTAATCCTAGGACTCTGGGAGGCCAAGGCAG
GAGGATTGCTTGAGCTCAGAAGTTCAAGACCAACCTGAGCAAGAGCAAGACCCCGTCTCT
ACTATAGATAGAAAGAAATTAGCCAAACAACTAAAAATAGAAAAAATTAGCCAGGCATGG
TGGCACATGTCTGTAGTCCCAACTATCCAGGAGGCTGAGACAGGAGGATCGCTTGAGCCC
AGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACACCACGGTACTCTAGCCTGGGTGACAGA
GCAAGAGTCTGTCTCAAAAAAAGTAAAAAATAATGCTTACCTTCAGGGAATAATTACTGA
GCGGGTACTTATCACAAGGTACTTCAGAAACACCAATAGTGTTTTATATCCTGATTCAGC
TGATAATTATGTGGGTGGGTTCACTTTGTAAAGATTCATTGAGCTTTTCATTCATTCATT
CATTCATACTTCATTAAAAGGTTTACTTAAAAATAGAATCAGGGGTGTGCTCAGAGCAGG
GGGCCTGAAGAATGGCTCTTCTGTTTACAACACACCCAACAGAAATCTCAGGACACTGTC
ATGAGGGACACAAAACTTGTGGCCTCCCTATGAACAAATGCCCTACATGTGAAAAAATAA
AAATAAAAATAAATAAATAAATAAATAAAATAAAAATAAATTAAAAAAAAAATAGAATCA
AAGGCAGATGCTATCTAAGTGGTCTAAGGCAGCAGTCCCCAACCTTTTTGGCATCAGGGA
CCATTTACATGGAAGACAATTTTTCCATGGACCAGAGGTAAGGGGATGGTTTCGGGATGA
TTCAAGCACATTAAATTTGTTGTGTACTTTATTTCCATTATTATTACATTGTAATATATA
ATAAAACAACAATTATACAATTCACTATAAGTTGGGGACCCCTGGTCTAAGATACAAGAT
GGAAGCTCATTTTCAGTTCCCTCCCCTATCCACACATGGAACCAACCCTTTAGGAAAACC
AGCACAAAAATGACCTGTCTTCAAATAAAAATTCTGCCAGAATCAGCAAAAGCCTCTAGA
ACTAACCGGTTTACAGGAAAAAAATAAGGAGCAAAGGAACATGTTAAATGGCACTGTAAG
AATACAGCCAGCAAAACCCAGCACATGTGAAATTCTATAGGATAAATGATTTGGTTTCAT
GAATAAATAAGTTGCAAGGAAAAAAAAAAAGGGGAAGGAAGCTATAATTAGAAATTTAAG
AGACTTATCAACCAAATGCAATGTATAGGCCTTATTTGGATGTTGATTCAAACAACCTGT
AAAACAATAACATTTATGAGACATCTTTGGAAATTTGAATGCTGATGGATTTAATATCAA
TTTTGGATGTAAAACTAGTATTTTGGTTATGTCTTTTAAAAAATAACTCTTATATTCTAT
TATTTTATGTGTTTTTAGAGGTGGGGTCTTGCTCTGTTGATCAGGCTGGAGTGCAGTGGC
ATGATCATAGTTCACTGCAGCCTCCAACTCTTGGGCTTGGCAACCCTCCTGCGTCGGTCT
TCTAAGTAGCTGGGACTACAGGTGCAAGCCACCACACTCAGCTAATATCTTTCTTTTTAA
GAGACGTGGTCTTGCTATGTTGCCAAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved