Microcebus_murinus Locus Mono:277:SNORD65
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:277:SNORD65
Microcebus_murinus
Mono:277:SNORD65
GeneScaffold_3484
SNORD65
1001..1073
2073
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCTGCAGTCTGTCTGAGTGCGTGTGCCTTCTCTTATTCCC
CCAGGTTTTGAGAACTGAGTGCTGGAATGTACAGGTTCAGAGCTGGCAGCCACAGCAGCT
CAGCCCAGGAGGAGGAGGTAAGCATTGATCTGGGCAATGACCCTGTGGTAGAATGAATAA
ACAGCTGGTTTTGTTAAAATTGATTTGAAGAAAAGGATATCATATGATGAAATCACCCAA
AATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGAGCCTATGGTTTTCTGAAGATATCT
TTTGTCCTGTGAGTGGCTGTTGGTTAGAGCAGAAAGTGAAATTGAAATTTAGTTTCTTTG
CAGGCTGTGTCCCCAGAGGATGGATGTCAGTCTGAAGTGAAGGACCAGTGGCTGTTATCA
ACTTGGATTCTGAAAACCTAACTGGCTTCAACAACATTGGTGTAGAAACATACTTGCCTT
GTGTAAGCAAGGACATTCTCAAGCCAAGCAATGTATTGGGCAACTTTTTTCTAGAACAGG
CACATTTGGTATCATTAAGTTTTCTAGCACTGTCCTTTGCTAGCCTGCCCAGTAGGAGCT
TCTATACCTTTTTAACAAACATACTTGGCCAGGCATGGTGGCTCACGCTTGTAATCCTAG
CACTCTGGGAGCTGAGGCAGAGTTCGAATCCAGCCTGAGCAAGAGCGAGACCCCATCTCT
ACTAAAAAATAGAAAGAACTTTAGCTGAACAACTAAAAAAAAATTACATATATATATATA
TACACACACACACACATACACATATATTGGCCAGGCATGGTGGCATATGCCTGTAGTCCC
AGCTACTCGGGAGGCTGAGGCAGGATCGTTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGC
TAGGCTGATGCCATGGTACTCTAGCCCGGGCAACAGAGTGAGACTGTCTCAAAAAAAACC
CAAAATACTAATTGGTTGTTATATTGGGGGGCAAGTTCTTTAAGATGAAAATTGTTAATT
CCTCCTGAAAGTAATGTTTTCATTCATTTACCATGAACTAATACTATAATAAAGGATACT
CTTTGGTATTGATTCTTAAAAATGTGTATTTGAAGAAAAAGCAAATTTGACTACTGCTGT
CGGGTATCAGCAGTTCCGATTCCCTGTAGTGAAAGCTTTTTGCTGTTAACAACTTCAGGT
TTTGAGGGCAAAAATTCCAGAGCATCTAAGGCATCTACACACTTGATTCTAATCCCTGCT
GCCTCTGGGCTCTGTCCCTTTTCATGGCTTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved