Microcebus_murinus Locus Mono:119:SNORA2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:119:SNORA2
Microcebus_murinus
Mono:119:SNORA2
scaffold_44412
SNORA2
1001..1137
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGTCTCATTTTTTACATTAAAATATGTATATCATC
TGCTCTCAATAAAATATTTGACTCAAATTTCCCAAGAATATATTCAGACTCCTTTTAAAA
TATTTATTTTAACATATTTAAACAATATCTTTGTTACAAATGATAACACTAATCACTTAC
CATGATGAAAATTAAAAAATTCAGTGCTAGTATCTGTGTTTTCAATTTAATTACTTTGAA
TTTCTCCACATGAGCATCTTTCAGTTATTGGCCTATTTACAAATATCCATAGTAAAATGT
GTTATAAAGGTGAAGTGAAATTATGTTTATGAAGAGTTTAGCACAGTAATTAGTCTCTAG
TGTTTTCTAAAACAGCTGCTTTTACTTAAAATGTTACTCTTGTGTCCCCAACTGAAGACC
AGCAGTTATACTATAGCTGTTGGTTTCAAACAGAGGCCTAAAGGACTGCTTTCTTATGGT
CCGTTGGCTGTTCTGGAATCTTAGCAGAGAATGGCTATTTCATTTGGAAGAAACAACCCA
CAGCTCTCCCTCACATTGGAAGAGCCTCAGGAATGCTACAAGTAATTACTTCTGACTCTA
AGAGACAGGGATAGCTAAGTTTGGGGAAGCGCACCTGCCCAGAATTATTTTATATTTGTT
GTCTTGTTGTTACTGTAAATGGGCATTGATAAGTCACATACTTCATACCACAATGAATAA
AATTCTAACCAAAGTGTCTTTATGTCTTTTAACATGAAAAAATTATAAAATATAAACAAA
ATTTAAAAAATTAAAAAAAAAGAAAATGTTACTATTTAAAATTTATCATTATTATTTCAT
TTCAGTGATTTAAAATGCTATTTCTGACATTTTGAAGCACAGATTATTATTTATATGCCG
GGTTTTACTTTTTCTTATTTTTGCATTCAAAATTATAGGTCAAACTTCCCAAATTAAGTC
TTTTGTAAGGTATAATTCCTTCTAGGAAAGCAGATTTCAAAATACCTTATTTTTCTCCTG
TAGGGTTGACTGACTCTTCCTTTTGGAGTTCTTGTTGTTCTCATTAGAATAGGCAGAATA
GAGTTGAAAGTAATTCCACATAGAAAAAGAAAGACCCCAAACTAAACACTACTGCTCAAT
TAAACACATTTAACTTCTGGTTATTTATATGAGTTGAAAAATGCCTGAGGATGTTAGAAA
CTGGTAATAGCTTCTTATGTATGATTACCTATTATATAATGCAGGTAATAAGTATAATAA
AAGCTTTTCAATTAATAAATAACCTATGTTGCAAGGCCTAAGTGAGACAACCTACAAATG
AACTTTGAGGACAACTTCTTACCCTTCATAATTTCAAAATGAATATTACAATTTTAATTT
AGCTTTACCATTAATATGAACACATCATAGCATGATTTTTTAATTTAAAAAATTAAAGCT
ATTAAGATAAATGAAAAGAATCATTTTACCAGAAAAAGTTGTATTCCAGAAAGCAATAGC
AATGAAGTAGAATATGTATAACTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved