Microcebus_murinus Locus Mono:280:SNORA52
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:280:SNORA52
Microcebus_murinus
Mono:280:SNORA52
GeneScaffold_1921
SNORA52
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCCCCCTGC
TACTAAATTTACTTTCTATTCTCAAGTCAATTCAATAGCAGTTTTGCTTTTCCTGGAGAA
GGGTCTTCTACTTTTCCACCAAAATTAAGGAGCCTAACACTACAACATTCCTCAAATTTA
CCTGTCTATCCTCTCTCTTTACAAACACCCAAACTCTACATTCAGAGGACAATGGGTTAG
TATGTCCAAATGGATTATACAAAGATTACATAATTTGGCAACTACTAAAAAAATAAACTG
TACGATAAAACAACCACTGCACTTAACAACTAGAAAGGACCCAAGAGATCACTGTTGTCC
AATTTCTTCATTTTTAAGATAATAAACTTCAGGGTGTGGCGTGATCTATCCTAATCCTGC
TGGCCAGCCTATGGCCTGCCAGGTTTCACTGTGGACCATAGCGCCCTGGCAGCCTCATCC
AAGGAGTGAGCAAGGGCTCATATCCTGGGAGCTTCTCCAGACATGCCAATTAGCAAAGGA
AAAAAAAAGAAGAAGAAGAAGAAAAGGGGGAGAAACTTCAGGGTAGAAAATATAAAATTA
AATGGCTTACATGAAGTCACCTGATCTATTGATTGAATAGTTAGGACTGAAACACAGATC
TTTAATTTTAGAAGACATCATTAGTATAATCACACTACTACCATATCTGCAAATAATATT
TCAAATAACCAATAAATAAAACCTGATTGTCTGAAGCTACTCCTTGATTATTAGTCATAT
TTGAAAACCACAGTTATCTCTCACCAAGAACAAAACAAAACTGATCATAAACCACTAGCA
ATTGAAAAAGAGGTGATCACAATAGCAGAGCAATCACAAATTCGAAATCTTTATAAGCGG
AGGTAAGTATTCTAATAATTTTTAAATCACATATAATTTAATGAAAATGAATAATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCAATCTTTGTTCTTCGCCAACCGTCCAATTCCTAGCCTCCAGAAAGAGTCTCTGTGCGT
CAAGGTTTCGGAGCAAATGCTGATACAGGTGGTACCATCAAGAGACAAATCAAGAATATG
TATAATCCAGATGAAGAGGTTAGAATCCTCCGGACTCCCTTTCAGTCTGACTAAACCTAT
AAAATCTGCATTTTAATGGCTGGTGCTCCAGAGATCACAAGGTTTCTTTCTGCACGTGCC
CTCCAAGGAATTAACGAGAGGAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved