Microcebus_murinus Locus Mono:288:SNORA28
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:288:SNORA28
Microcebus_murinus
Mono:288:SNORA28
GeneScaffold_1060
SNORA28
1001..1126
2126
TACAGTTGAGGAAACTGAGGCCCAGAGAAGCTAAATAACTTCCCTGAGGTTCATGTCAA
ATTAGTGGCAGAGCTAGAGTTTGAATATAGTCATTCTCTTCTACTTTACTATTCTGTTGT
GATTTCTTACCAAATCATAGCATTTTAGTGCCTAGAACCAGACCAAGTTGGATTTTATGC
CATCTTGAATTTTGTTCCTCAGCCAAGTGGTAGATCTCTTTGAGTCTTCTACATATTTAA
TAAACATGAATAAAGAGTGTGTACTCTGAGAAACATAAGAGATAAAAAAAAAATGAATAA
GCCTGTTTCTTCAACCACGTAACCTGTCATATGGAGTTAGAGAACAACAAAAAATAATTA
TAATTAAACATCAGGTGTTTTAAGACTGGAAAGGGAGTTTGAAGGAGGAGATATATCACT
TCTCCGAGGAAATCAGATTCATGTCATTGTTCTAGGAGTTGGTATTTGAGGTGGACTTTG
AAGGTAGGTAGAGTGAGAGATTTAGTGGGGAGGGAATCTAGGCAGAGGGAAGAGGATTCA
CCAGAGTGCTTGGTTTTCTTGGAAATCTGAGGACATGTGGGGAGACCCTGAGGAATATGA
ATGGTAAAGTGGTTTGTTACCACACTGGGAGGTCTCATTTCAGCCAGATTAACTGGAGAG
CTATTGAATTGAAGGGAGTGACAGAATCAGAAATGTGTGTTCAAAGGTTTGGGGCCAGGG
TCTGGAAAAACCTGGAAGAATAGGGTTTTTGCTGAGTATCTGAATGAATACTCACTTCCC
TTCAGTATGACTTTCTCTGGTTCTACAGTATTAACACAAACCATGTTACTCTGCCAAAAG
AAGTAAAAATTCATTTTCTCTTTTCACTGTTTGTCTCACTTCTTCATTTTTATGCCTTAC
CACTGGAGTCACTTCTTATGGATTATGAAACATTTACTGGTTGTAGATGCAGCCTCTGGA
TGTACATTACTATGACTTTTCCAATAACACATTCTTACTGTAAGCAACACTCTGTGGCAG
ATAATCAAAACTGTCTCTCAGAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCC
GGTGTTCTCCCTTCCGTGAGACAAGCCGTTATATGGACTTACACAGTATAAAAAGAAAAA
AACCTTGGAAAGATACAGTGAGGGCGGAGGGGTACCTGTCATATGTCAAGGGTCATTCAT
CTGAGAGAGGCCTTGCCTGACTTCTCTCTGCAATAGTTTGCCTCTTACTGATGTGCTTAC
ATTTCATAGCACTTTTATTGCCTGAAATTATATGATTTGGTTTTTCTCTCTCCTGGACCA
GACTGAACTCCCTGAAAGCTGGAGCTGTGTCTGATTTTCATCACTGTATCCTTAGTGCCT
GGCACAAAATAGGCACTCAGTATATTTTGATTTAGTGGTTACTATTGTAGTGATGGAAGC
TGGTTAATGATCAGAGAGACTTGTTAGGAAATTATTGCAATAGTGGAGGTGGAGATGAAA
AGAGGGTATACATGAGAGGTGTCCTTCATTGTACTGGGCATGCAAGAGAAAGTTGTTAGT
GGTTATTGGTCAATATCAAATAATGGATGCTATTACTAAGACCCAACTTAGGTTGTTAAA
GCAAATGCTCATTAAAGTTTGTTTTATGGTTCTATTATATAGCTAATTCTTTTCAAATCC
GATATTTTATTTTATTTATTTATTTTGAGACAGAGTCTCCCTGTGCTGCCCAGGCTAGAG
TGAGTGCCATGGCGTCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCAAGCAATCC
TCCTGCCTCAACCTCCCAAGTAGCTGGGACTACAGGCATGTGCTACCATGCCCGGCTAGT
TTTTTCTATATATATTAGTTGGCCAATTAATTTCTTTCTATTTTTTTATAGTAGAGACGG
GGTCTCGCTCAGGCTGGTTTTGAACTCTTGACCTTGAGCAATCTGCCCGCCTCGGCCTCC
CAGAGTGCTAGGATTACAGGTGTGAGCCACCGCGCCCAGCCTTAGATATTTTATTTTTAA
AGGAAATCTTTTAAAAAAGAAAAATGTAATTTTCACAAGTATTATTGCATTTCAAAGTAG
AGACTGAGGCCTAGATATAACATCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved