Microcebus_murinus Locus Mono:315:SNORD77
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:315:SNORD77
Microcebus_murinus
Mono:315:SNORD77
GeneScaffold_3911
SNORD77
1001..1068
2068
AAATATACTTTAAATGGGTGTCCTTTGTGAGGTTGCAAAGAGATTTTTCATTCTTGCTT
GTCCTTGAGTTTAAAGGACTTACCTCCCCTATGCTTTACTTTCTCTGTCTAGGGTGACTA
TGCCACTACGGAGCCCCTACTTCCATCACAGGGTGGTTATTCAGATAAAACAAAACCTGG
CCCATCACCCAAACTGTACAAGTAAGGAGGACATTTAGAATCGATCTAACATAGATGACC
CAAAACTTAGGGAAAAAAAACTCAGGAGGTAACTATCTGTCTTCTGCCTACCCTTTATTA
TTCATGGAGAACTCCTAGCCTCCCTGGCATTCCAGTCTGTCAGTTTCCATAGGCAAGAAG
TACTTGGCATCTATCCTAAATTTCTCTTCTTGTTTTGTAAGATTATGCCCTTTCAATGTG
CCCTAGTGGATGTACAACTGCTCATTTCTTCCTTTAGGAATTTGTTGTGTTACACTGAAG
TAGGCTGCTTACTGGTGGGTACTGCTTACTGGTGGTATCTATTTGGGAATTGCAGGGATA
GGGTCTCCAATTTGCTCCTGGGTCCATCTCTGGTGATGCTGGAGCCCTCATCCAGCAGAA
AAGGCTCCTGTGTCCAGGGGAGTCTGTTTGACTTGCACCACGTGCAAAGATTAGAGGAAG
GAAACCAGCTCATCAAGGAAAAAGAAACACCCCCCCCCAAATTTTCCAGCTAAAGCCTGT
CAGTAAGAAAAGAGATTCAAACTCCTAAAATTGAGAGAGCCAGATTGAGCATTTTAGGAT
GCTCTTTAAGTCATGTTCCTCTGCTCCCAGTTCCTGGTACTTCATTTCCATGCCAATCAG
AAGACACCTATCACTGGCCAATTTTGTTATTTTCCTTCTTTTGGCACATCGGATTGACTA
ATACAGAAAGCTCTCCCATCTGTGAGCTGTCTGTAGCCTTCACCATTAGCAGCCTCACCA
GGGCCAAGCAGCTGCAGAAGCCTCTTTGAAAAATGGCTTAGATGCTAGGATGGTTGCATA
GTTCAGCAGATTGAATCATTAAGAGATTCACCATTTGTCTGATGTATCTGGGAACAAAAA
AATAAAATAAAATCACTTAGAACATTGACTGGACTTGGCAGCAACTTGCTTTGGAAGCAC
CAAACCACAGGCTCTAGCTGGCATTTGATTTGATTAACTGAAATGTGGACAACCATTTTG
CAAACCATGTTCCCATAAGCAAGCAGCTGTGGCTCGGGGCCCCTGTTCAGGGTTACTAGG
CTGAGCCAAGACATTCCCCTCTGACAACAAAGACAAGAAGGGGGAAGCCAGGAACAGTAT
CAGAGTTTGGGAGTGAAGGAATGTTCTGGCTAAAGAGTACCAGATGAAAGAAAGTCTTTG
ATATACTATGATGTTCTTCAGTTTCAACTAATACATTTATTCCTTTGCTGCTGATAAAGG
GACTTTGTTGTGTTCAAAATCCCAGAATGGTCCCAAAGGTCTGAACCTTTGTCCAAGTCA
TTATCTTCTCTTGCCTGGGCTGCTGCAGCATCTCCTAATCAGATACCCTGCTTCTTCCCT
TGCATCCATTGTCCATAGAGTGCTATTTTTAAAAGGCAGGCCTATTCATGCGATTCAGTT
GCTTAAATTTTTCTAATGGATTCCTATCATGCCTAAACTAAAATTCAAATTCCTTATCCT
GATTTAAAAGGGACCTGTCTCATATGACCCTTTGCAATTTCTCAAATTTATTTCTACGAC
TCTTCTTTACCTACTATCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved