Microcebus_murinus Locus Mono:225:SNORA18
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:225:SNORA18
Microcebus_murinus
Mono:225:SNORA18
GeneScaffold_2988
SNORA18
1001..1128
2128
CCAATTAATTTCTTTCTATTTTTATGGTAGAGACGGGGTCTCACTCAGGCTGGTTTTGA
ACTCCTGACCTTGAGCAATCCGCCCGCCTCGGCCTCCCAGAGTGCTAGGATTACAGGCGT
GAGCCACCGCGCCCGGCCAAAGAGACCCTATTTCTATAAAAAGTTTTAAAAATTTAGCCA
GATGTGGTGGCATGCACTTGTAGTCCTAGCTACTTGGGAGGCTGAGGCAAGAGAAATGCT
TATGACCAGGGGTTCGGGGTTATAGTGAGCTATGATCACACCACTGCACTCCAGCCTGGG
CAACAGAGTGAGACTCTGTCTCTAGAAACAAGAAACTAAACAGCTGGACACGGTGACTCA
CACCTGTAATCCTAGCACTTGGAAGGCCAAGGCAGGAGGATCTCTTGAGGCCAGCCGTTC
AATTTCAAGACCAGCTTTAGCAAGAGCAAGACCCCATCTCCACCAAAAATAGAAAAAATT
AGCCAGGTGTGGTGATGCATGCCTGTAGTTCCAGCTACTTGGGAGCTGAAACAGGAGAAT
CACTTAAGCCCAGGAGTTTGAGCTTGCTGTAGCTAGGTTAATACCACGGCACTCTAGCCT
AGGCAACAGAGCGAGACTGTCTAAAAAATAAATAAATAAAATAAACGAAACAACCCCCCC
ACCATATTTAGTGCAAGAATAAATGTAAAAACTGCAATTGACTAGTAGATATTACAGAAA
TTGAAATGATAGTCAAAATTATTTTCTTGCATAACAAACTCAGTGCTAGATAGTTTTACA
TTTGAATTCTATAAGATTTCAAGTTATAATGAATTTTTACCTTATGTCAATTGTTCCAGA
ACATGGATAAAACATTTTAAAAAGCTACCTGCCTCATTTTTTGAGGCTGGTAAAATTCTA
ATTCTGGTTCCAAAATCAAAGACAAATCAACAAAAGAAGATTAGAGTCGTATTTAACTTA
TGATCAGAGATGTAAAAATCTTTTTCATAAAAAGTTAATTTGTTGAAGTCTACCCCAGTG
GGGCTCTTACTGTGGCCAAAGATCACTAGAAACTTCTCATAGCGTAGCTCTGTGATTTTG
CCTAACTCACAAGACTGCTAAATCTGTGGGAAGAAACTATAAGACAGTTGCTAAAACTAT
GAAAGACCTAATAATAGGTTTTTTTTTTTTATAACCTTAGGTATTAGCACATCCCACAGG
ATCTGTGTTATTCTTGAGTGTAATAGCTGAGGAATGAATATGATTTGAACACATTCATGT
TTGGAGAAGGTGTCAAACTGAGAACCAGACAGATCCACCTACTGTAAAAATGATGTTCAA
GTAAAACTGCCTGAAGAAATTAGATCTCAAAGATTCTTGGTGGGGAAATTTTTGAAGTTT
TCATCAGTATGACCATATTCAAGTGGAGACAGAAGCCAAAATAAAAGAATTTTGGACTGA
CAGGACAACTGTGGTATAAGCATCAGTTCTTTTAAAAAGAGCTATCTTGACAATAAATCT
TGACTCCAGCTTTAGAAGAACTACAGTGGCCTTGATGGGCAGTGAAAGGAATCACAACAT
GTGAAATTCCCCAAATAAAAATGTATTGACTTTTAAATAGTTTTGCCTAATGTTATATAA
TAAAAAAGCTCTTTGAAAAAAAAAACATTTAAAAAGGCAATTTAATTCGAGTGTACCAAA
AATATTTAGTTTGAACTCTATGATATAGCCAATATTTGACCATTTTTTGACCTATAAAAC
CAGCAATTTCATATGATTCAACCTAAGAATATATTATGAAGAAGGGTATACCCCAGAATG
CAGGGATAGTTAAATATCAGAAAAGTTTTCAAGGAAAATCACCACATTAGTAAACTAAAG
GAGAAAGCTGAAAGATTATGTTATTAGATGGAGAAAAAAGCATGTGATAATGCATACCTA
TTTAAGATTAAAAATCAAACAGCTGGCAAAATAGAAGGATACTTTCAAACTTAAATTTAT
AAATAGAAAATATAACATGAGAAGATACTTGCAGTAATTTAAGTCAACAAAGAATTAATA
TACAGGGAACTCGTACAAATAAGTACAAAAAAATGGTAACCCCAATAGAAATCTGGCTAA
AACATACATTCTCAAAAGGCTGACAGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved