Microcebus_murinus Locus Mono:294:SNORA30
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:294:SNORA30
Microcebus_murinus
Mono:294:SNORA30
GeneScaffold_790
SNORA30
1001..1113
2113
GGTACAGGCGGGCTATGGGCGCCACGACGGTGTTTTCAGTGTGTAATTCTCTGAACGCA
GAGAAAGCAATCAGAAGGGCCTGGGTTAGGGCATTGGCAGAGGGGACACAGAAAGGGAAT
GAATCAAAGGAAGTTTTATGAGTTGGAATTGTTAAGATTTGGTGAACAAATAGGCCTAAA
AAGTGAAGGAAAAGGAAGAGGCAAGGGTGACCCAGGTTTGGGGCCGAGACCCCCTGCGCT
GAGTGTCTAGTTTGCGCTGGGTGCTTGCGACACATCATGCAACACTATTTCATTTAGCCC
TTGCAACAGCTGGTGAGGTTGGTGTCCTGTCCTCATTTCGGATGATGAATCAGAGCCTCC
AGGGGCTTTGAGAGCTCGCCCAAGGTCACATAGCTACTAAGTAGTGGGAGGAGACTCTGA
GCCCAGATCATTCTTTATACGAGACCAGTTTAGGACACGTTGGGGTTTGAGGTGCCGTGC
AGATGATACAGGCATCCATGCTTCTGATGCCCCTAGGAAGAACTGGCTTGCAGGTAAGGG
GTTTAGGTGCCAGGACAGGAGAGACTTAAGGCTGTGAACAGATGAGATTTCTGCAGGAAT
GCTCCTAGTGAGAGCAGAGAACCCTGAGGAAGCTTCGAGGAACATGAATCAACAAAGGAG
CCTGAGAAGCAGCATTCAGAGAGACACAAGGAAAGTGAGGGAAGATGGCTTGTTAGGGAA
CAAAGGATGTGAGGCCTTTAAAAAGACCAGAGGCAATCCTGGCAAATTTCACACCGATGT
CAAGGATGAGACCTGAGAAGTACCCACGGCTCTGCCAGTTACGCTCTTTACGCTGCCAAC
CTTCAGATTTCAGGATTAACTTCGGCCATGCCCTGCCCCCGCCATACCTGTCCCTGAGCC
CGGACCCCACAGCACTCAGCACAGCCGGCTCCTGTGTGTTGTGGGATTCCTCACTTAACG
TCTGCCCACACACCAGACCTCTAGGAGGGCAGGGACTACATTTTGCTCATCACAATTCCC
TCTAGGATTTGGTAGCTGGTGCTGAGAGAAAACCCTTGATTTCATCCTTGCCCTGGGATT
GTACCAGTGGCAACTGTCACTCAATGGGACAGAGACCATTCTGTGACTTCTTGCTCAACT
TTATGTCTTTTTCCTGTTACTCTAATCTTAAAAAAAAAATAAAAAGCAATTCCCTGGAAC
CTAGCACAGGGCCTGGCACCAAATGGGCACTCAATAAATATAACATATTCACCAATTGAC
TCCATAAGTTGGGAGTGACGGGCTGAAGCCAACACTCTGCTCCCCCCCAGTGTTGGGAGC
TGCTCTGCATCCTCCCCACGCGAGCAGTCAAGGGCGGTGAGCGCTGGGCTGTCTCTGGCA
CAAGGTGATTAGTGGGCAGAGCTGCCGCCCAGCATTGTGAAATGGCCTCAGAGGCTGCAT
CTGACCTTGAGCCACCTTTTTTTTTTTTTTTTTTTGCTTGGCTAAGCACGGAGTCATTCG
CTTGTTCCTGCTGCCGTTCAAGCCTGGAGCAGTGGGCTTAGCACAAACAAAGACATGATG
GTTGTTTTGTTTGTGGGGAATCAATTTCCCTTAGACAATAATTTCACAGGTCGTCTGCAC
TTCCCGGTGGGGTGGCAACAGGGATGTGAGGGAACATGGCAGAGGGCTTCCAGCACCAAT
GCCAGGTCTCTCTGGGCCTTTGAAGAAATGTTTTCCTATAAACACTGGCTGCAGGAGAAA
AACCATAGTTCCAAAAGCCAGGAGACTGGGTGAGTCCCAGCTGAGCCACTAGCTGGCCAT
GTGGCACTGGGTAAGTCACTCATGTTGTCACTTAACATGTACCCTGTGTCTGGGCATCTC
TCTTCTCCTGAAAAACGTGGAAATGGCCTCCAGTTCCCCTCCAGTGTCACTGTGGGCATG
TCGGCACTGCTGCAGGGGCAGGGCTGGGGGGAGGCACTTACAAGCAGAGACTGCCTCCCG
GACCCATGACAGCCTCCAGAGCATTTGTCGCTAGAGCAGGGCCCAGCATGACCCTGCGGT
AGCATTGTGGTCAGGAACCCTATTGCTCCAGCCTTGGTGGCACTGGGTAGGAAGCTAAGA
CGGAAGTGTGGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved