Microcebus_murinus Locus Mono:263:SNORA13
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:263:SNORA13
Microcebus_murinus
Mono:263:SNORA13
GeneScaffold_2331
SNORA13
1001..1123
2123
TCACAGGGAGACAAGCCTGACTGTAATATCATCAGCAAAAATCCAATTTGTTGTACTGG
GCCCCGTGTGGATTGACCTTGTGCTCACAATGGCAGTGCCAAGCCTCGTGTGGGAAAGGA
AGTCAGACACCAGAGTTGGCTGTGTTTATCCAGTACAGATTGTTCTCTGTCGAGAGGCAA
TTGTGAGTCATCAGGCTTTCCAGACCTGGATGAAATATCTCTCAAAACTATCCCCTCAAG
CCGGGCACAGTGGCACATGCCTGTGGTCCCCGCCATCCTTGAGGCTGGGATGGGAGGATC
GCTTGAGCCCAGAAGTGCGAGGCTGCAGTGAGCTGTGATCACACCACTGCACTGCAGCTT
GGGCAACGTGGCAAAACCTTGTCTCAGAAAAAAAAAAAAACAAAGCAACAACAACAAAAA
ACCTATCCTGTCTTTTATACTTTGGTTTTATGTTCACCAAGCAGTATTTTGATTAGTTTC
CCATGTACCTCACTGCCAGGAAAGTGGATCCGGCATACAGAGAACCTTGTCAAGGCAAAG
AAACAGCCACTGTTATTAGTATTAATCAATAAATTAGAATTGCAGTTTATAAAAACTTCT
TAGGAATGTGGTTTCCATAAGTCAGTCTCCTTGCGACAGATGAGCTCTAGGAATCCTAGC
ATGGCCAAGTTTCCTCCAGCACCAAGACTGGGCCCAGGGTGATGGAGCTGCTGCCTTGAG
AGGGCCTTTCTGGGCTGCCAGCCAGATGCCTTCCTTCTCCTCACCCCTCCTTTCACCAAC
AAGCATAGTTGTTTATTGACTGCATAAAATTCCAGAAGCTCAGACAAGAAGAAAACTTTT
GAGACTCACCAAATAAATTATATGTTAACAAAATAGAAAATTAAAATTTAAAAAATCCAG
GAAATAAGTAAAAGTCAAAGAAGGTAAGAAATTTTTCAGAAGGCTAAAAATGAGTAAAGA
ATCACATAGCATAATATGAATTGAGAAAACAATAGTATTAATAGCTTTCTGTTGCCTGTT
TACTTTCAAAACTAGTGAATGTGGTGTCAAAAATGTGTAAATTAAACACTTATCAGCATT
TTCCTGTTCTTAAATTTGGTGTAGGAGCTGCGTAAGTAACAGTTTAAAAAAAAAAAAAAA
AACAGTTGAGAAAGGCTGGGCATGGTGGCTCATGCCTGTAAGCCTAGCACTTTGGGAGGC
CAAGGTGGGAGGATGCCTTGAGGCCAGGAGTTCAAGACCAGTCTGGACAACATAGTGGGA
CTCTGTCTCTATGAAAAATTAAAAATTTAGCTGGGCATGGTAGTACATACCTGTAGTCTC
AGCTACTCAGGAGGCTGAGGCATGAAGATGGCTTAAGCACATGAATTTGAGGTTGCAGTG
AGCTATGATGACACCACTGAGCTCTAGCCTGGGCAAGAGAGCAAGCCTCTGTCTCTAAAA
AAAAAAATTGAGAAAATAATAGGGACTGTATGATTCAGAAAAGTGGCAAAAGACAAGAAC
AAGCAAAGGCTTTGGAAGACAATGAGAGTAACACCACCCTGTAGGGAGAGAGATGGAAAT
TTCCATGGTGCCAACAGGAGACACTCTGTCACATAGAGATAGGTGGGCCCAGGAAAAATC
AGGAAGCAATCAGGATGGTCAGTGTGAAGAAAACCTAGGCTGGGGAATGGGGATTCAGAA
GGACAAAAGGCTAAAATGCAGTGACATGAATATGATGGCCTCACAGGTATGAAGGGTTTA
GCATTTTCATTGCTCACTCTTTTAGAGGAAAGATAATGAGCTGAAATTTTTTTTTTTTTA
AAAAAAGCTAAAACCTCCCATATTTATGAAACTATTTTATAGCTTTAGATTACTGTCATC
TTTTTGCCATCAAAAACTTCTCGGGGCACCAAGAATTTGAAATGGCAACAGACAGAAAGA
CTTCTTTAATTGAAACAAGTCTTCGATCAGAAACTGTTTAACATCCCGGCACAAACCGTA
TCCCAAAGAGCTAGTCATTGACAACCCTGGGCTGCTTTGAACAGTCCAGCAGAGGTTGAG
CTGCTGCTTGAACACAGCGCCTGGATTTTGTGCTTTGAGAGGTGAATCTCCACCAGGTCC
AAACCCGCTGAGACAGCATGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved