Microcebus_murinus Locus Mono:144:SNORD116
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:144:SNORD116
Microcebus_murinus
Mono:144:SNORD116
scaffold_55025
SNORD116
1001..1095
2095
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGTATGTACAAAAACCGGGGAAGCACGCAATGCTTTAAGTGCCGAGCCTACCGCAGGGG
CGTGTATGTGTGGCTCCCTAGAACGTTTCCCTGTAGGAGTCCGCCTGTGGCATTTGTCTG
GTCTGGTGGCCAAGGGAAGGGCTTTTTTTCAAGGTGTAGCTGGGTGTCGAATTGGTCCTT
CTGACAAACCTTTGAGATAGGGACGTATGAACATCCCTCCGGTGCGACAGAGAGCTGCAG
GCCCAGGGGCTGTAGGGCATGCGTCGACAGAAATCGGGAAGCCCACGGAGCTTAGATGCA
GGGTGAGGGTCAGGACTGTGAATTGCATTGTCCTCTCAGCCAGCGTCCCTGTCTACCGTT
CTGAAGCGGACCCGTGTTCTTTGAACTTCCCCAGAATGTGCGGCCACGGAACGAACAGCA
GCAGGGAAGAGCTCCGTACAGTGGCGCCGCTGGCCATGCGAAGAGTTCCGGTACAGGTGT
GGCGCGGAATAGTTTGGGTGCTGCTGGACCTGTCGGCAAGGTGAGCCTCTCTTTCCCACC
GCACGCAGCTTTCCCTAAAGCACAAGGCGAAAACTGTGCCTGGATCGATGGTGACTTGCA
CGTGTGTCTTCCCCGTTGGAAAGCTGAACAAAATGGGTGCAAACTCTGTAGCGTCATCCC
CTTCAAAGTGAGGTCCAGCACTGTGCTGCCACATGGAATGGAGAGAGAGGGACAGCTTCC
CTGTGTTCCCCTGGCTAGAGCTCTGGGTTAGTCCGGGCTTGGGGACGTGGTCCCGGTTGA
GCAAAGGGGAGCCGCTGGGCACTTAACAGTTCCCAGGTTAGGGGATGGCTGTACGGAATG
ACTGCAGTTGGTTAGGGCAGGATATCACACCTCTAGCTTTCTGGGCTTTGCGAGTATACA
GGCACACAGGAAGAGTTAGTGTTAACTTACCTCTGAATCTACAGTCTGGGTCTTGAGGTC
GTGGCACCTAGGGACCTCGTAACCTTCCCCCCCCCGGATAAAATAACTAACTACTTGCGT
TTGGCAATAGAGCAGAAGGCCACGCGTTGGCCATCCTGCGGTCATTTTTCCTTTTGGCCG
AGGTGATTGAGTCCCTATGGTGATTGGGCAGAAGCAGGGGCCGGTAGTCACAAGCAGGGA
GATCACACTGGTTTTGTTTTCGCTGTGGTGCACGGGGTGAGTGTGTACGTGCTGCTTGTG
CGTGTGCGGGGATCATCAGAGTTCCCTGCCGGGCGATGGCTCCTGCAAAATACAAAGGAA
GAGAGCCGTGAGTGTGTCGACTTGACACCCCTGTGTGGGGATTACTGAGCGACCACTGTG
AATCTCCTCCAGGGGTTGTTTGGCTTTGGAGGTGCCGGAGCCAGCGGGCGACGTGCGCCC
ACGGCACCTGGAGTTAGGGGGCGAGGCTGAGAAATGAAGAGACAACAAAAAGATGGGGAC
GGGAGGACGGAGTCCTTGCTGACTGCCGCACCTCGTTTATTTCCGTTGCTGTATTTATAC
AGATAAGAACAAAGGAGAAGCAAAATGCATTGGAACAGGTGGTGCATGTCTTCATTAAAC
CAGAAAACAAAACAGTTCTTGTTTCTTTTAACCTTACGTCACTTTGATAGTCCTTTCCCT
CGCTTAAGCAGTTTTCTAATCTACAACTTAACTTTTTTCTGATATCAAAAAAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved