Microcebus_murinus Locus Poly:13:SNORD81
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:13:SNORD81
Microcebus_murinus
Poly:13:SNORD81
GeneScaffold_1379
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1080, 1488..1548, 1714..1795, 2084..2151, 2412..2473, 2734..2798, 3546..3619, 4127..4202, 4352..4428
5428
GCGTGCTCAGGTGAGGGCAAAGGATTAGGAAGGGGGCGGCGCCCCGGGACCCGGTCCAG
GCGGCAGGCGTCGGCGGGCGGAGAGCTGCCCCGAGGTGGGTGTGTATGGCTGGGTGTGTC
CCGGCGGCGGTGGGGGAGGGGGCCGCCCATCCGGGGGTCCTGAGGGAGGGGCCCGCGAGG
GGCGGGTCCTGCAGCTCTGCCCAGCCGCGGGCCGAGGGGGCAGAAGGTCGCCGGGTGCCT
CCAGGCGGGGTGAAGGGAAGTGCTGAGAGCCCCAGAGCGGACTGCGGAGGAGACGGGCGA
GAGGGCCCGGTGCAGGGCACGGGACGGGGTGCGGGCCCGAGCCCAGTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGCGTCACCCGGGCAGTCTTGTCTCCGCCGCAATGGCCAGGTGGGGCGG
GGCAAAGGGGCGGGCTTAGAGGGCGGGAGGAGGTGGGCCTGGAGGAGGAGGTGAGATTGA
GGGAGGAGAAAGGGAGGGGCTGAAGCTGACGCTGGCGCGACGGTGCGTCATGACGTCATC
AAATAACCTTTATATAAGACAGCTCGGGCGCCATATCGTTCTTTCGAAGCTAGGCGTCTA
GTTGAAGCGAGTAAGTGGCGTTTTCGGGGGTCTTAAGTAACTGGTTACAGGTTCACATCC
TCGGTCCTTCGGCCTTTGTCGGGCTAAACTGGCTGGCACTTGTAGGCCGGTCGCGCGCCT
TTACTGTGCCCACAAGAGGAGGATGGTGAGGGATTGCGCGTTTGGTGCAGGCGCGACCTA
GAGGGTTGTTGGGGCCGAACGGCAGGCAAACCTCGGCTCGCGTTCCCTGCCTCTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGAATGTTGATGAATGCCAACTGCTCTGATGGCCGAA
CGCGAGGAGTTGACTGAGTGGGCCTTTGTGTAGGACGCGGTGGAACCACCGCCGTCGCTC
GTTCTCGGGAAGACGGGTGGTTGCGTTAGTCCACGTGATTCTCCGGGTGGCTCGGTTTCC
CAGTGCCGCCACTGTTTCCATCTATAGTTAACTGGGTGCAGTGCTCTCCTTTGTAACGGT
AGGTGCCTCTACCTATCGTGCAGTTATGGGTGGTAAAGGTTAACTGCATGATTGGTAACA
AAAACATAGCAACGTGGGAACGATGATTTTTAAATCTGCACCTAATTTTTTCCTTAGGAA
TGGTGGTAGGCTTGGATGCAGTGTGGCCTTTGGTGGCATGTTATCAGGTACGAATGGGGG
AAAAATTTGGTGGGAAAGGTGAGATTTGCTTAAAGGTGGTCTTCATTAAGCCTGTGATGG
TTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAATTCTATTCTGAGGCTTTAATTTTTGG
AACATTGATACTTATTTAGCTTGGCTGCAGTGAGGTTCTAACTTGAATCTTGCCTGTTTT
CTAGTTCTGTGCCAAGGGAGTGATGAGAGTAGCTACGGAGGTAAGTTATTGAAACGCCAA
CTGAAAGGGAAGTTAGGTTGAAAGTCACCGAATGTGCCACAATGATGACAGTTTATTTGC
TACTCTTGACTGCGAGAATGACGAGATTGTTAACCACCATTATCCTAACTGAGGCACACA
AAATGGTGATTTGGGAAGCTTGAATGTTGTCCCTAAGTTAACAAGAAGCTGTTTCTTCCC
AGGTCCTAAAGAGCAAGCCTCACTGTTGCTGTGAGCACACAGGTGAGAAACTTTTGTATA
AAGAAATCAGTATTTACCCAGTACTTCTTACTTTCTTTTGGGATTAAGAAAAATAGCCAC
AATGATACTGATGTTTCTGTATTAGTTTTTCACTGTTATTTTCAAATGTGAACTGCTATT
ACTTTGATACTAAATTTAATGCTGTGGGAAACCTGAGGAAACAGATACCATGATGGTTGC
ATAGTTCAGCAGATTGAATCATGAAGAGATTTACCATTTGTCTGATGTATCTGGTGGTTA
GGGTTTGCTAACATTGTGAGTACTGCCACCTTTAAAATCTATTTCTCATTTATTTTGTAT
TTAAAATCTATTTTGTAGGCACTGAAAAGAAAGCTGGAGGATGAAATGGTAAGTAAAATT
ATAATCCAAGTATGCATAGGTAACTGGGCACAAGTAGCTTTTTAAGAGTTAACATTCTTA
ATGTTTGAGTAACTGAGATCCTTGTCCTGTTACCATCAGTACGGTAAACACAGTCAGAAT
TTATAAATGCTGCCTGGATGATGATAAAGCAAATACTGACTGAACATGACGGTCTTAATT
AGCTCTAACTGATTTCAGGCCATTTTTAATCTTGGGAGGAGAAAATGTGTGTGTAACTAT
ACTAAAACCACTTTTTTTTTTAGATGGAGTCCAACTTGTTTATACCAGCTTTATATTTTT
GGTAAGTATTAATGGAAAACATTATAATAATTAAAGACTTACAGTGCTAAGTGATGGGCT
TAATGCTGAGCAAGTGGCTAATTAAGACTTATAAGCTTACATTTGACTAATGAATGCTGA
CTTTGTTTTCTTTGCATGCTCCCTAACAGGGTTTTTGTAATGATGTTGATCAAATGTCTG
ACCTGAAATGAGCATGTAGACATATTTAACACTGAAGAACCCTGTAACAAACTGCTCTGA
AGAGAGTTTAATAATATATAGCATTCTAAAGAAGGTTCTCACTTTTTTCTCCTGTAGCTA
CTGGTTACACATTTTTTTCCATGGACAGCTTGCTTGGGTAAGAACATAAAGACAATCCCT
GGCATTTCTGAAATGTGATCTTAACTACTTGTGTTAGTGTGTTCACTTGTGGTAAAAAGC
CAATGGATCTAGGAGGCCGAGGCAGGAGGATTGCTTGAGACCAGCCTGAGCAAGAGTGAG
ACCCCATCTCTACTATAAGCTACTTGGGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGG
AGTTTGAGGTTGCTGTGAGCTAGGATGACTCCACTCCATAGCACTCTAGCAGGGGCACCA
AAGTAAGACAATGTCTCAAACCCAATGGACAAAATTCTGAAAAGAGAATGGTGTCAAATT
ACTACGTTAAAAAGTTTAGTGAAAGTTTTAAATAAATTTTTAGAAAAGTAAATGTATGAA
TACTTTATAAAGTAAATGGTCTTCAAGTTTAGGAAATAGCATCTAAAGCAATACTTATTT
CAGGTGAAGACTTAAAATATAGGACTGACTTTTTAAGAGGCAAGGTCTCCCTTTTTTTTG
CAGGCTGAATGATCCTGCCACAGTCTCCTGAGTAGCTGGGACTGCAGGCATGCGTCACCA
GGTCCAGCTAGAACCTTTCAAGGTGTGTATTTTATTTGTCTTACATGTTTATTTAGCAAG
ATGCTGTTAGTGATGATTTTCAAAGTAACAACAGATGGGAATCTCTCTGAAAGAGAATGA
AGGTTAATTTGGAACTGAAACAGTAATTGGAAATTTTTTAGACATCTCCCTATAAGTACC
TATTGCTAAATTAAAATAAATTTCCACAGGTATGAAGAGTAAGCTTGACAGCAGTGCATG
GAGCAAGTTTTCAGAAGAGGTATTGGAATTTCACTATGGGTTTTGTTAAGTGGTCTAAAG
CAGATACAATGATGATAACATAGTTCAGCAGACTAACACTGATGAGCAGTATTAAGTCTT
TCGCTCCTATCTGATGTATCTGGCTGTAATAGTTCCAGTTTATACCCTTTGAAAAGTGAA
ATTGTAGCTACTTAACTATCCCATAGCAAATGTTTAGGGGGTTTGGATTAATCTGGATTG
GAGTGACAGCAGTTTTAAAAAGTGTGACTTTAAGGTGTGACTTTAAAGGAATAATGAGTG
GAGCCAAATTGAAATGGAATTGTTTTTCATGTTCAAACAGGCAGACCTTCTATTCTAAAA
ACTTCTAGGTAAGTCAGTTTTTGGTACATAAGTTTAACTTGGAATGTAACCAATGATGTA
ATGATTCTGCCAAATGAAATAGAATGATATCACTTAAAAACCGTTCCATTTTGTTCTGAG
GTTACTGTATTAACAGATAGTACACAGAAATTTTTTTGCCATGATTAATAGGTAATCTTT
GCTTTTCAGGGATTTCATATGACCACAGCAAAGCAGCATGCAGCTTACCCTTCAAAAGGT
GAGGATTGAAAATAATAGTACAATCATTATTCCAGAATACATGATGATCTCACTGCAACT
TGAACTCTCTCACTGATTACTTGATGACAACAAAAGATCTGATATTCTGTGTTCCCAAGT
TGCTATCTAAATTGAAATCCAAAAATGTGTCTGAAAGTGGTTTTTGTTGCAGGCACTTTC
ATGGATGCTGATGGAAAGAGTAAACAACATCTTTCAATGTAATAACTTTCTGCAAACCAG
CTGGAGGAGTGATTATTCTAAATGGGATGAAAGAAGGGAAGTTAACCCAATCAAATAATG
AAGGGATGTTTTAGTTGTTTGCCTGTTAATTTTAAGTTGAAATAAACACAGATCATTAAG
ACTCCATGGCTTTTTACTTGATTTTTGTGGACTAAGATGTTTTGAGGATGAGCCATATAG
ATCGCAGAATTCTTTATTAATGAAATCCCTAGATTGGTTTTGAGCCTAAAGCTTTGATCT
TAAAGGCACCTTTGAAAAGGTTGTGGAGAGTGAACCAGAGACCTGAAAAACGAGAAAATC
TTTGACTAGGTTGTGTTCTGTTTTCCCAGGGACTACATTTTGTCTAGAAAGTCCACCTAG
TGCAGGTGTCCTCAAACTACAGGCCACATGCGGGTGTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTATTTAACTGCCTATTTAAAGATCCCTG
CTTGGTTCACAATTTAGTGCTTAAGTGGTCTACAGATTTCTAAGCATTCATCTTTTTTTT
TTTTTTTTTGAGACAGTCTCCCTCTGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved