Microcebus_murinus Locus Mono:41:SNORA51
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:41:SNORA51
Microcebus_murinus
Mono:41:SNORA51
scaffold_271
SNORA51
1001..1132
2132
CATGTTAATATAATGACTCTTTGTACTATATAATTATCCTTTACAATATTGCTTTATGT
TGCAAATATATGTTGTGATTAGGTCCCCAGTTCATTATCTAGTTATTTATTCCAGTTCTC
TAATAATTAACAAATGTGAAATATGATCATCTTCGTTCTGCTTTCTTTTCTGACTCCAAG
ACTAGAAGATTCATACAGACCATTCTGTAAGACCTGTGACACCTTGTTCTCCAAATAAGT
CAAAGGTTTTTTCCCAACAATTTTGAGATTTCCTGAGAAACCACATGGCACTGAATTCCA
GCCTTGTAACTCATGTCAGACTCTGTGGTTACCTTTTAACTTATCAAATTCTTGTCACCC
TGATCAACAGAACCTATGGTGAGAAAACTTTCTCCCTGGGTTGTTTTCCTGGTAGCTTGA
AAACTGAAAGAAAAGACAAGGTCAAAATGTGCTTGAAGAAACATTTGCTTCACATTTAAC
TCCAGAGTACTAAATAAATTCCCAAGGATTCTACTAGCCCACGTGAGGTCAGGCCTGTTG
TGAAAGGAAAGGATGACAATTGACCCTTTCTTAGAGCAAAACCTCCTGCCTTCCATCCCA
CCAGTCAACTACAGAGTCAAGATCCTGAGAGCTGACAGCTTCCACTGGAGATAAATTCCA
GCCTGCCCCAAATGAGCCATGTACTTACGAAAAGAATCAGCAGAGACCTCTGGGACCAGC
TATTCCAGCAGTTCCCAAATGCTCCTCCAGCCAAGATTCCATTTCTCTCCTCCCCCTCAT
CTCAGCCATGGACCACGGGATTTGGAAAATTTTTTCAACTGAACTGAATATGTCAAATAT
AACAAACTATATTGTTGTTCATATTTGTTCATCTAAGATAAATATAAATGTATGCAGTGG
AGCTTCTGAGCCAAGGTCCTTATCCCATGATGACTTGAAATAATTTTTAACCTAAAGTAA
GGAAACTTGAGATTATCCATGAGATCTTATAAGGAAATTCAGGCCTCCTGGTGTTTACCA
CAGTCTGTGTTCTTACTCTGACTGTCTAGAAAGAGGAGGCAGAGTAAACCTACCCCATAT
ACACCATAGCCCAGGCCCCGTGCCTGGTCTGTACTGTGAATGGGAGGACATGGAGAAGGC
AAAAAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved