Microcebus_murinus Locus Poly:18:SNORA71
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:18:SNORA71
Microcebus_murinus
Poly:18:SNORA71
GeneScaffold_4578
SNORA71, SNORA71
1001..1134, 3547..3680
4680
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCGGGTA
TGTGCTGCTGCTCATGAGCACCGTGAAGGAAGAGGGGGGTGCCTTCCCGGTTGCCTCCAG
CTGGCCCCAGCAGACGGGGTGGTCCTGGAGCTCAGCCCGCCTCTGAGGCCTGCCTGGAAG
GCCCTGGTGCAGGAGGAAGCGCCGTGTAGCAGACGCGGGGCTGGGTTTGCGTGGCTAAGT
TACTTCATTCCCCTGAGTTTGACTTCCTGTAAAGTAGGGAAGCTGCAAAATGTTAGGGCA
GAGACCTTGACTGTTTTTGTTTTTGAACCCACATTGCCTGGCTACATGTAGATACTGAGA
ATTTGTGGGGTGAATGAACAATTTAGGCGTTTTTTTACCAGAAGTTGGTCTTGCTGTGCA
CTCTGTAGATGGGGCAGGTGGGATTGTTATGCTGTATTAAGTGGTGACAGCTCTTTGGGT
CCTGGGCTTGGCTGGGCCCCTCTCCCCTTCCTGCGTGGTTAGTGGGAGCTAACTCGACAT
CTTGGGCTTCTCTTTGTGGGTTACTTTCTGCCCTTTCTTGGCCCTGCATTCGAAAGTGAT
CGTGGGCTGCCCGTGCCCTGGTCATTGATAGTGCAGGGAGAGGAATTGCCGAAAGCGTTT
CCCCGTGTTTGGAGGGTCTGCTCCCGTCCCTGCCAAACTCTGGAGCTTTCCCACACTTCC
TCCTTACCACCTTTTAATGCCTCCCGGTGTCTGGCTTATTGAGTATTCCTTGTGCAAAGC
TGTGTTTGCCTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAAGACTCTGCAACTTTCTTACCTGG
AGGGTCTTCTTGGCCTCTCCTAGCTGGGCAGGTTAAGTTCATGCCGGACAAGGTGGCAGC
TGCTGGGTCCTGTGCTTTGCTGTGCCGCTGTCCCAGGTCAGGCCGTTTTCTGGGCTTCCG
ACACTGGCCTCTGGTTCCAGCAAGCTCAGGGTCCTTTTCTACCCTTGTGCTCAAGGTGAT
TATAGGCTGCTTGTGTCTTGGTATTGGTGATGTTGTTGCAAGGTTATCCTCATGTGCAGA
GGGTCCATTCTTGTCCACTCCACACGGGACAGCCTCAGCGGGTGGTAGCAGTGACCAGGA
AGGGCTAGAAAAGCTGACAGTGCGTCCACCTCCTGAGACGCTGAGTCCCCAGGTGTTTTC
CCGTGGGTGAATGCAGGGTTCCCTGGACACACCCTATTCAGTGCCAAGTGCATTCATTAC
TTGCTGGCTTCTTGTCCTCTATAGGAGTGTCACATGATGCTGCTCCATGTACATCATGAG
AGGTGTCCTCAGGGAGAGCATGGATTGTGAGGTCCCAGGTAAGTGGCATCCTGCCTGGTT
CTCTAGAGCTCAGGTTCTCTGCAGGCTCCGGGGCCAGAGGTTTAGGTATCATGGAGTGTG
AGTGGGAACACAGATGAAGGCCGCTACCCTTTGCTCCTGGCTTTGTCCCCTTGGCTGTCA
GGGACAGGCCTGGGTCCTCTTTTGCCTTGGTGAGGCTGCTGCAGAGAAGGTGCTTCCAGA
GCTTAGTTCAGGCTCTGAGAGTCACTGAGAGAGGCTGCTGTTGTATTGAGGGGAAATCAG
CAGTGTGCTGGAAGGGGCAGAGGGCTGCGTCTTAGGCTCAAACCTAGATCCAGATCAGTG
GCCCCCTGAGTGGTCTTTGAGCCTCAGTGGAAATACTGTTGTCAGATAATCAACATTGTT
ACCACTCGAACCCAGTCTTTCAGAGCACAAGGATTCTCAGCGTTTTTGCCAGCATTGGCC
TTCCCTTTAGCTCTTTGAGAAGGGGAGTAAGTGATGTCTGAGGATCAGGCAGCACCTGTA
ATCTTAGGCCACAAGTCTGATTATTCCCCAGGGCGCAGGCACGGCCTCCTTCTCTGCCCT
CGTCTGCCCCTGCATTCGAAAGTGATCGTGGGCTGCCCGTGCCCTGGTCATTGATAGTGC
AGGGAGAGGAATTGCCGAAAGCGTTTCCCCGTGTTTGGAGGGTCTCTACCTGTCCCTGCC
AAACTCTGGAGCTTTCGTACACGTCTTCTCGGCAGCTAGGGCCCTTCTGCCAGCACAGTG
TGGGCTTCGAGGAGGCTTAAGGAAAGGATAGTGAGGCAGGGCCCTGCCTTGGGGAGTTTG
TGTTCATGGGCTAGTTTGGAAGCCACAATAGTGATCACCTTCCTCCTAAGGCTCCCCCAG
AAGCTTTTTCTGCCTCCCCATCTCGCCCCTGCCCACATCCGCAGCCCTGCGTCAGCGGCG
ATCCCACCATCTGGGAGTGAGTTGTTAGTTTGCTCATCGTGCCCCCTGTGCTGTGAGCTT
CTTGAGGGCAGTGCGCTGTCTTGTTTCACGTCATGCCTAGTGCCTGACGTGTAGCACCTG
GACAAAAAAAAACCAAGAAGACATATCATTGTACAGTGCAGGGCTCATCCCATTGAGCAG
TGTCAGGGTGAAAAGTGCCCTTGAGCAAGCAGCTATGATAGTCCACCTTTAGTCCTGGCC
AGGAAGGGCCCATGGGCCACCAGGGGTAGATTTTCCCTCTTGCCTTAGATTAAGGTGACA
GGGACTAGAATACTAATCAAAGTGGGCAAGGCACCATGTAGTTGGATATATGAACGCAGC
CCTTAAATGCTAGATGGTCAGTGTGGGGCCCTCCCACCACCCGTTACCTGTCCCAGGTAT
GTGCTAGTTGCTGCCAGGCATGGGCCACTCCCCAAAACTCCCTAGGCTCAGCATTCCTTT
TTTAAAGTAAATTTTAGCATCAATATTTGAGGTTTACAATATGTTATGGGACAATGGGTG
ACATATAGACAGTAAAATGGTTACTATAGTGAAACAATAACATATCTGTCATCCCACATA
GTTCCTGCTTTCAGTGTGTGTGCCAAGAGCAGCTAAAGTCTACTTATTTAACAAAAATCC
CTGATACAGTTTTATTAACTGTACAGTAGATGCATTAGACTTGTTCATCCTATGTATCTG
CTACTTTGTATCCTTTGCCCCATCTCCCCATTTCCTCTCCTGCCCCGCTGTAGCCGCTGT
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved