Microcebus_murinus Locus Mono:221:SNORA62
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:221:SNORA62
Microcebus_murinus
Mono:221:SNORA62
GeneScaffold_850
SNORA62
1001..1148
2148
AGAGGGAGTGACCTTATATTGGTGGCATTTAAAGCCATAAGGTTGGAAGAGATAACCTA
GGGAGTGACTATAAACAGAAAAGAGTCCTTGGGTATGAAGAAATCACCATTTTAAACAAT
TTTAGCCTAAAGTTCCTTTTTTTTTCCTTCTTCTTCAAGTTATTTTCTTTCTTCTTCAAG
AATTCCAGCTACAGGGCCTGGCACAGTGGCTCACGCCTATAATCCTAGCACTCTGGGAGG
CCGAGGCGGGAGGATCACTCAAGCTCAGGAGTTCGAAACCAGCCTGAGCAAGAGTGAGAT
CCCATCTCTACTAAAAATAGAAAGAAATTAATCAGCCAACTAAAAATATATAGAAAAAAT
TAGCCAGGCATGGTGGCATATGCCTGTAGTCCCAGGTGCTCATTAGGCTGAGGCAAGAGG
ATCACTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGATAGGCTGATGCCATGGCACTCTAG
CCCGGGCAACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAGAATTCCAGCTACAAT
ATGACAATCCTATGAGGATGAATAGCTACACTGGTAAGCTATTTTACAAAACTTGGCTCG
CCAGGTGTGGTATAATTCCACCTCTTCCCCACGGGTACGGTAAACGATTCACACAGTGCC
ACTCACCTTTCAAAGTAAGCTGAGACTTCTCGAAAGGCAGGGCCACTCCTGCCCGGCTGG
AGCTGGCAGATGCCATATCATCACCATGAACCTGCAAGACAGAGCAGTGGGTTTAGAGAA
TATCTGATAAGACGACTGAGGAGCTGAACTCAATTTTAACATTTAAGTTTAAAGAAACAG
AGGCAAGAAAACATAAACATCCAAGCAACAGTGGCCACGCTACTTCAGACAGGGTACTGT
CTGTCTTCTGATGACCCTTGAACCTGGATAGGTCTTGGATGGTCTAGGAAGGACACAGGA
CTGTTACATGTTATAACAAAGTGTGGAAGAGAGCAAGGCTAATTACAACATCTCCAAAAA
AAAAAGTCACAGCTTAACAATACAAAGACAATTTAATCTAGTGTGTTACATGAGAGGCAA
GTTTTTTGCCAATATCATGAGGGTCTCTGGCCCAATGAATAGAGTTTGATAGTAATCCTT
GCTATCAGTATAATGTAAAAAAAAAACAAAGAAAGAAAAGACAACTAATCCAATTTTTTA
AATGGGTAAAAGATCTGAATAGACATTTATTCAAAGAAGACACCCAAATGGCTAATTAGC
ACACTAAAATAATCTCAACATTAGGCATCAGTTATCTCTGTCTCTGTATCTTGACTAAAC
GCAGAAATCTATCTTGCACTTTGAATGGATCTTTTTCACATGTGATTTTGGAACACCATC
ATTTGTCATTTGGAAAATATTAGTTCATTGAGTTATGCAGATACGCCAAATGTTAACACA
TTTCATTATGCAATATAAAAAAATTATATTTGTGAATGTCACCACTAACTTCATCAGACA
AGTCTTTAAGCATCAGGAAGCTGTTGAGCTCTTGGTGGTAAAATAAGTGTTCCAAAATTC
TAATTTCACTTAAAAACTCATATTTTAAGCCGGCTGCCATGGCACATGCCTGTAGTCCCA
GCTACTCAGAGCTGAGATGGAGATCGCTGAGTCAAGAGTCATATCAGCTGGGCACACAAG
AGAGACCCGTTTCAAAACAACAAAAAAAACACCCTTATATTTATCATAGGCAGCAAATAC
TGTCAGTGGTTTTCCTTAAAGTGTCAGGCTCACTTCGTTCATTTTCAAGAAAACGTCTGC
CAATCACGCAAATCTAGTAACGTTCATTTGTCTACTAGTTTTTTGTGTGTTTTCTTTTAA
GTAGAAATGGTATTTCACCAAAAAAGCAACTAATCCAGCTCCCAATCCAAACAACCATAC
CCCTGCTTTCTCTCGACACACGGTCAAACTTCAACGTGCAGCAGAGGAGCTTTGGGCGTA
TTTCCCATTGCAACAGACAGAGTATTATAATGAATGTGCTCAGGAGTCAGGACTTCATCC
AATTAATAAATGTTACTGCTTCATCAAGGACATTCTTACATGAAACTGGCATTTTCTTTT
CTTTCTACTGAGAGCGTTTTGTGGTGAAGAATACCATGGCAACAGCACG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved