Macaca_mulatta Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Macaca_mulatta EEF1B2
Macaca_mulatta
EEF1B2
12
SNORD51, SNORA41
3242..3320, 3594..3723
5298
AGACTATTCCGCAAAACAAAAATAACCTGTTTATTCATCAAAAAGTTATTGTTACACTT
CTATACTGTCAATTCGTGTGTGAAGTTGTGTCTGATCCAAGACCTCACGGTACAAGCATA
GATCCCAATAACTTGTAAACAATATTTTGTTATTCGCAATGCAACCCTGAGCTAACTTTT
CAAAAAGTCATTTTTCTCAATTTCCCGTTAGTGAAAGGAATTTAAAAATTCTGTCCAACG
TGGTCAATGGACAAAACAAATAAGGACAACAGAAGCGTGAGCCACTGCTAACACAACAGC
GACCAAACAATCATGTACTGTACCAGGCGTGTAAAAATCTGGGGGGAAAGGCTCAGTCTT
AAGGCTTAAGTCATCGGACACTGGTCCTCTCCCGGGGAATAAAACGGCCTCCTCTGAGAG
GGGAATGTCCTGAATTTTCCCTGCAGAGGGAAGGTCACCTACAAGCCCGCATTCGGGCCA
GCGCTCCCGAGGGCCCCCTAATCCTCATCTTCCTTTCTGCTCCATCAGACCAGAGACCGT
GGCTAAAAGCCCCACTTGCCGGCTCTCAGAGGCTTCCGAGGCGGCGGGGCGGGAGGCGGC
TGCCAGTCAAGGACAAGAGAAGACTAAGTCGCGTGGGCCAAAGGAAACAGTCCCGTCAAT
AAATAAGCCTCTGACCCATGCACCTCACCCTTCCCATCCATACAAGACCTCACCTTCTCC
CCGGAGCCGCGGAGGCTGTTCTGCTAAACTGTCTGGACCACAACTACCCCCTTGGAGGCC
GGGTCGCTTACTCAATATGGCGGCCTCAGCTAACTCTGTCAGCCGGGCCTGGAGAACGGA
AAGCCCGGAGGGACTAGAATCCTTGCATTCGATAAGTTTGTCGGCAATTTCCGTCAGCCG
ACCAGAGGGCGGAGCTGAGGTCGGCCCAGCCCGGAGGCGGGAAGGACAACTTGGACCCGC
AGTTCCGCCGGAAGTGGCCGGCAGCCTCGAGGCCGAGCGTCTTCGGTCATCTCCGGCGCT
TCTAAGGGCGGTTCCCGTCATCTTCGGGAGCCGTGGAGGTATGAACTTAAGACATGCCCA
TTTTATTAATTTATTTCCAAACGCAACGAAAGATCCAGGGACAATTTGTGAGCCGTTTAA
TTCAGGGCCCCCAATTCGTACGTGGAGAAGTGGGAATGCTAACGTACTTTGACCTTTAAC
CTTCGGTCCGGCGTGGTGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTTCCGGCTT
CTCCGGGCCCTTTTTCCTCTCTTAAGCGCGGGGAGCCCACAACTTGTGCGCTCTCTTTCT
GCTGTTTCCCAGCTCTCGGATACAGCCGACACCATGGGTTTCGGAGACCTGAAAAGCCCC
GCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATCGAGGGGTGAGCG
GACCGGCTGAGTCGGGGTGGTGGAGGGGTTTCTGGGACCGGGGCCGGGGCCACGTGGCGC
AGCGTGTCGGCTGCCGCTGGAGGGAGGGAGACCGGGCCCCAGGGCCCTTTCGAGGATGAC
GGGAAAGCGCCCCGTGGCCATCTCCCAAGGCCCTCGTGTGGTGCGAGCCCGGCCTCCGGG
GAGCGGCTCACGAGCAAAGGAAGGTTAAAATGTGCTTTATTTACACTTAATTCAGCCAGG
TGTTTCCACATCGCTGCCCAGTTAATACATGTTAGGTTGTAGATAGAGCAACGTTAGAGA
TTGCAGTATTTGAGGTCTGCAGACATTTCTCAGGATAGCGCGGTGACCCAAACATATGGT
TTGATTTTAAGGAGATAATAAGAAAAGAAAAGCATTAAAGCAACCCTACTGGAGTTAGTG
CCCACTAATTAATGTGATGCATAGGCACTGATTATTTATTCGCTGGCGTTTGTTTTTCAA
AGGTGTGTGTGAATGTCTCTGTGTCATTGGCAGGTATGTGCCATCACAAGCAGATGTGGC
AGTATTTGAAGCCGTGTCCGGGCCACCGCCTGCTGACTTGTGTCATGCCCTACGTTGGTA
TAATCACATCAAGTCCTACGAAAAGGAAAAGGCCAGGTAAAATCATCTTTGTATCTAGCT
GAAGAATAAGACTACTCTCGAAGCTTTATCAGGATGTTCACATGACAAAACTAGACCCAG
GCTACTTTAGTTTTGTTGGGGTATTGTAAGCTAAATTTTTCTGTAACCTGAGAAGGCCAA
GAGACTGAAGCCCTCCATTTTTTCACAGAACAGGTAGAACATGGACAGCAGCAATTCAAC
TTTTCCCCACACTGCCCTGCCAATGTGCCTCGACCTTGACCTGGGGGGCCCACCTCTGGG
GTGAGAGGGTGGCTCATTCATTCAGTCCTTGGCCATTCTTCTGAAACTGCCAACAAGGGT
GGAAGTTTGGGGAAGTGGACTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAA
TCTCAAACAGAAATGTTCATACTGAAAGAGTAAATCATAGTGAGTATTGAAAATAATGTC
TCACATGGTACTAATGCTTGTCGGGTGAGGAGTTGAACATATGATAGTGTTTACCTGGGA
GCATGTGAAAGGGTAAATTATTATTGCAAAAGGGATCTAGTGATAAGTAGTGATTAAAAC
AAGTTATTTTGTATTGTCTGGAAAAGTATGTTATACTAGCTCAATAGTGGTTGAATTTAA
ATGTTTTTCAAGCCTGCCAGGAGTGAAGAAAGCTTTGGGCAAGTATGGTCCTGCTGATGT
GGAAGACACTACAGGAAGTGGAGCTACAGATAGTAAAGATGATGATGATATTGATCTCTT
TGGATCTGATGATGAGGAGGTATGGCATCTTCTATAAAGAATATATCGGCCAGACACGGT
GGCTCACGCCTGTAATCCCAGCATGTTGGGAGGCTGAGGCGGGTGAATCACGAGGTCAGG
AGTTCAAGACCAGCCTGACCAAGATGGTGAAACCCTGTCTGTTCTAAAAATTTAAAAAAA
TGTGGCGGGTGTCTGTAATCCCAGCTACTCAGGAGGCTAAGGCAGAGAATTGCTTGAACC
TGGGAGGCGGAGATTGCAGTAAGCCGAGATCATGCCACTGCACTCCAGCCTGGGCGACAG
AGCAAGACTCCGTCTCAAAAAAAAAAAAGAATACATCGATCAGCAATTTTATCAATGTGG
TTAAGCCAAATTGCCTGGATTTGAATCCTGGCTTTAACTTATATGCCTTTTTCAAATTCT
GACTGGTTGCATGATGAATAAAATCAAATCACCATCTTTCGGCTGAGTTCGTGATGGATT
TGCTTTTTTCTGATTAAGCCAGTCTTTTTTGTGATGACCCCACTAGCTTTAAGCAGAGGA
CAACCAACTTTCTGAAGTGGATTAATTTTTTTTCTTTACAGGAAAGTGAAGAGGCTAAGA
GACTAAGAGAAGAACGTCTTGCACAATATGAATCAAAGAAAGCCAAAAGTAGGTCATTTG
TTTTTAACTTCATTTCATGATAATGTAAGTAATCTTTTTCAAAGCTTGACCTTTAAGTAA
TTTCCTCCACATTCCTTGAACAGGTCAATATTTTAAAACCTCCTGTAGAAGTTCTTCCAC
AGCTACTGGTCTGCAGCTGTTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAA
ACTGTTAACACAAACACCTCTTTCTTAGCAAAACAGAAAGTGGGCATATGTGTGACAGAC
ATAAGATGTATCTGTAGTTTTGTTTGGCTAAGGAGATAGTCAATCTCAAAACAAATTGAG
GTGATTTGTTTGTGTCTTGGAGTAAGGTAAAAAAATACAGTTCATTATTTGAATAATGCT
GTTTATTTTTTTAGAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACC
TTGGGATGATGAGACAGATATGGCAAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGA
CGGCTTAGTCTGGGGCTCATGTGAGTTTAGGCTTTGCCTTTTTTTTTTTTTTTTGAAACT
GACATCTGGAATTTGTATACAGCTTCAACCTTCCTCTACAAGACTTTTCTAACTAAGATT
TTTCTTAATGCTCTTTTTAGCTAAACTAGTTCCAGTGGGATATGGCATTAAGAAACTTCA
AATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCAC
TGCTTTTGAGGACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAAAATCC
ATCCTGGATCATGGCATTTAAATAAAAGCTTGAAAGATTACCTTTGGCTCTTGAGTATGT
TACATAGGAGGGTGGTGTATATATTCCTTTCATTTTGAGGGAAGGAATTAAATGAATATG
TGATTCCTAAATAATAAAAATTTGGTTCGGCTTTGTTGTTAGAAAATTGTAGTGCAGGCC
AGGTGTGGTGGTTCATGCCTGTAATCCCAGCAATTTGGGAAGCTGAAGTGGGTGGATTGA
TACCAGGAGGCTAATACCAGCCTGGGCAATGGGGAGAGATCCTGCCCCTACAAAAAAATA
CAAAAATTAGCTGGGCTTGGTGGTGCACCCCTGTATTCCCAGCTATTGGCAGATTGAGGT
GGGAGGATTGCTTGAGCCCAGGAGGTTGGAACTGCAGTGAGCCAAGGTTGTGCGACTGCA
CTGCAGCCTGGGTGGAGCAAGGTCCAAAGACCAAAAGAACCAAAAGGCTCTTTTGACAGC
AAGGTCCTGTCAAAAGAAAAAAAACTGTAGTGCAGCTTTACCCATTTGTGATGTCCTTAG
CAATGCCTGATGATGTGATTTGTTGTAACCTGTCATCTTTGCATTGGGAACTTGAAGATG
TGAGATGTGTGACGCTACTAGAAAACACCTAACCCAGAGGAGGGAGGGCTTCCCAGAATT
TGGCATGAATTATAACTACTTAACAGGTTACAAATTTAAAATGATGACTCATGTTGTAAA
TAAACCATCTTTTAAGTGTTGGGAATGTGATTTGGAGTATAGCACTGTGTCCTGGGAGGG
GGATTATAAAGGTAACTGGTTCCCAGGCTTCCCAGGAAAACTTGACTTTGCTGTGAAGAT
TCATAGGTGCTAGGTTGTGGAGGTGGAATATTTTACTTGGATTTGGAAATCTGATTGGTC
CTCATGCAGCAGGTAAATACTGGGATGAGGGTAGTATGTTGAGTAAAGTGATAGTCAAGT
ATTGGAAACAGCTTCATCTTGACAGGGAATTTGAGGTCTGGCTAACATTTGATAGTTTTT
TTGTTTGTTTTTTGTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1332..1432, 1953..2075, 2712..2838, 3401..3467, 3854..3979, 4100..4298
1353..1432, 1953..2075, 2712..2838, 3401..3467, 3854..3979, 4100..4251
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved