Macaca_mulatta Locus RPL37
snOPY snoRNA Orthological Gene Database
Macaca_mulatta RPL37
Macaca_mulatta
RPL37
6
SNORD72
3162..3241
4433
AAAGCAGCTCCGGCAACATTTTATTTTTAGTTTTCTTTTCTTTTCTTTTTTTTTTTTTG
AGACAGTCTCACTCAGTCACCTAAGCTGGAGTGCAATGGCGTCATCTCAGCTCACTGCGA
CCTCCACCTCCACCCTCTGAGTAGCTGGGATGGCAGGCGCGCGCCACCACGCCTGGCTAA
TTTTTTGTAGAGACAGGGTCTCCCTATGTGCCCAGGCTGGTCTCCAACGCCTGGGCTGAA
GAGATCCGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCGTTAAGCCACGGGGCC
AGGCCCCTGGAAACCATTGAACAAGTTCCATGTGTGATTCCTCGGCACAATGAAATATGG
GATCAGATAACTTGCCTCTGATTTACTACAGTAACGACAACAATAACAAAAATCACTATT
TGCCTTTCCCTTTACATCCTAAGCTCCAGCTCCAGGCCTCCGTACTCCTCGCGACCTCTC
ACAGGGAGAGTCAGCGTCGGCCAAGAGCTTCCGGGATCGGAATGAGGAGGCGGCTGGAGA
AGTTGCTTTCTCCTGAATAGGGCTGATCCCAGACGCACACGGTCATTACACGCCGGGGAC
GCTCAGTCGGTGCGTGTACCCCCAGGCAGGGCCGGCCACGCATTCCAGGTTCTCCATGTG
CCCAGACGACAGTAATCCACGGTACGGCAACAGATCTGCCTGCTAATGCGCGAAACCGAT
CAGCAGTAACAGTAGCACCAGGAACGGCGGCACGAAAAGCCGCTCACGGTCCAAGGGGGG
CAGGCGAACACTCGGCCAACCGGTCGCCAGCCAACTGGGAGTCCCACCCACCTTTCCGGC
ACTGAAGACGCGATTGGCCGCGCCTGGTACCGCATCCTCCTCTTGACCCCACCGACACTA
CGGCGACGGACGCTTGGGAACGTTGCACAGCCCTCCGCAGGAAGTACTTCCCTGGGCGGA
AGCTTCTGAGCGTGATATAGCGGAAGTGCCTTCTCTTCCGGTCTCTCTGGTCTCGGCTGC
AGAAGCGAGATGGTGAGTTGTGACGAGGGTCTCTGTGAATCGCGTTCCATCCTCGTTCTT
TGTGCCTCCCTGTCTGCTGTCCTTGGGGGTCTGGCAAGATTCCGGATAAGGGGAACTGGT
GGGCAGAAAAGAGGCATGCAGTGGCCCTCAAGAGCCAGAAGAATGGCTGCTAATTGGTGC
TTGGGGGACCGATCCCGCCGTAATTGTGGAGCTAGAGCCGCATTGTGTCCCTTGCTTCGG
TACAACCTTTGGAGACCTTTCATAGCTCTAGCCTTGTTTGGGAGCTGAAGGAAGGAGTTT
GGGAATGTTTGGCTGTGTGTAACAAATAATTCATTGGTGATGCTGTCTGGCCGGAGTCTA
TAAAGATAAGGTATATTTCAGAACGTTGCAACTCTTGTGGAGGGCTTTAGGTAACGTGAA
ATGCTGGTAGTGGTCTCTGACTTGGAATTCGTGGAGTCTTCTCCCACAGTTCCGACCTTT
ATGATTGCCTTTAGATTTTATCAGTACTTGGTTTCCCGGAGAACTCGAGAAAATCTAGAA
ATTGCCGCGTTTCATAATTATCTATTCCTTTAACGTGCAGACGAAGGGAACGTCATCGTT
TGGAAAGCGTCGCAATAAGACGCACACATTGTGCCGCCGCTGTGGCTCTAAGGCCTACCA
CCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGAAAGTGTAA
GTAACATTTTTCAGACCAACTGTGTTAGCTTTTGTTTGTATTGCACTTAAGTGGGGGCAT
AGGTTTGAACTTTATTTGGTGCCTATCTTAAAACTTGTACATCTGTATGCCGATGAGGTG
GCATAAAACTCGTGTGTTAACAATACCTACAAGGTGTGTGGGGGAAAACCGTTTGAAATC
TTTTCTGAACTTTGTTTTAGATAACTGGAGTGCCAAGGCTAAAAGACGAAATACCACCGG
AACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGGTACAGTTTGTATGT
TCGATCATAATTGGTCCTATGGGCTTGAATGAAACCCTCGTGTTTACTTGTAAAAATAAC
ACTACCCTGATGGTTACTGGGGATGAGTTGTTGGAAGCATTTTTATTTTTGGTGGTTGTT
GAGACAGGGCTTCACTATGTTGCCCAAGCTTGAGTGCAGTGGCACGATCACGGCTCACTG
CAGCCTCAGTCTCCCCAGCCTCAGGTGATCTCACCTCAGCCGCCCGAGTACCCGGGACTA
CAGGTGTGCGCTGCCACATGCCCAGCTAATTTTTAATTAGTATTTATTGTAGAGAATGGG
ATTTTGCCATGACCTAGGCTGATCTCAGAACTCCTGGGCTGAAGCCATGGGCCTCCCCAA
AGTGCTGGGATTACAGGCGGGAGCTACCGCCGCAGGCCAGATGTGAAAACTTTTTATCTT
CTGCCACTGTAACCTTGAGATCAGTTACTTTGGATTTTATTAGTTTTTTCACTAAACAAT
AGTATAAATTAAGTTTCAGGAGCATTTTTTGAGCCAGGGTCCCAAAGAGTTGATATTTAT
TATGTTTATCTTTAATTGGTGTCAAAATTTGTCAAGACAGTAGTGAATAAGATCTGGGAG
TCAGGCTTTGTTCAATCTTCAGTATAGTGGCTGTGGGCAAGAGTGCTATAGAAAACAGCC
CTGATTGTTGCTGTTGCCTTAAGGACAGCCATAGGTGTGTTCATGTGCTGAAGAAACTTT
CTTTGCACTTAGAGTCATACGTTTTTGTGGGCTTAATGTTGAATGGGCTGTTAGTACGAT
ATAGGAGTTAGGAGCTTGAACTGAAGCCAGGCTTTTAAAAGTAGGATAGTTGACCTCTCT
TAGAGTAGATATGGATGTTTAGTAAGTTAAAATGCAAAGCTCTTGGTTTAGAAAATGTCT
GCCATTAAACATGCTCATTGTTTTTTCCTTGCTTAGTCAAAGCGGTTGTGATCTATTCTC
AGCATAGGGAACCATTTTCACAAATAATCTTTGATCTCTTGCCAAGTAAGAACAAACATA
CTGGCCCTTGACTAGTATAGCCAAATAAGTGTTTGAGCCTTAATTGCAATTGCGATTAAC
TATATCTGAAAATGGGTATCTTTAAGCAAAGTGAAGAATTGCAGCTTATCAGTGATGTTG
TAAAAATAAATGTCTGAACATATGAATGCAGTACTGATTTCAGCATTTAACTGAGATAAG
CGCATTGAAATCTGTTTAACAAAAATTAAAATTGATTCATCCATGTTGCTGAAGTAACTT
GTTCTTGTTTTTGACATCGTGCAGGCATGGATTCCGTGAAGGAACAACACCTAAACCCAA
GAGGGCAGCTGTTGCAGCATCTAGTTCATCTTAAGAATGTCAACGATTAGTCATGCAATA
AATGTTCTGGTTTTAAAAAATACATATCTGGTGTGTGCTGAGGTATTTTTAATCAGTTAG
ACTTGTAGTATCAGTGAAATAATGTAGGTTTAAAGACTGGGCTAGCTTAATACCAGATTT
ACTTGTTAAGTGACTGTTCTGGAATGTTTCCTTTGGACTGGGGTTGTAATGCGGTTTAAG
GCAATGACTAACAAGCAGAATTCCAGGAGTCCTTGAAGCAGAGGGCACTGGAAGACAATA
CAGCAGATTAAAATAGCACAGCTCATGTGGCATAGATGGGTATTTAAGACATTCGAGTAA
ATTGGAAAGAGCATGATGTTTAAATTACCTTTAGTAGCATGTTCGTTTGCTATACCGTCA
TGACTTTAGGGGGATGATTATTAGTCACATAGAGCCTCGGAGTACCACTGGAAACATACA
GGTAGGAGTTTAGGTGGCTTCTGTTTTTCAAAAGATGATCTAATCCTAGTATCTATACTG
CTCACTTGGCACACCTGGCTGGTGGGCTGTGTAAGGTGACTAGCTAAGTGAAAAAAGCCT
GCTAGGTGTGACTCAGGAATAAGTAGGTTTGAGAAAAGGTAGGGCTGGGTACAAGTAAAG
ATTGAGCAGGAAATAAAGGAAAATCAAGTAAAAACCCTGAGATTTGTAGACTAAAGGCAA
TGATGTGGGACTACTTGGTCGAATTTTTTTAGCCCTCAACTAAATTAACTTGGGTGTTTC
TGTGCTGAAGGAAGCGCTGAAACTTGCTGTCATGCCTTCACAGTTTTGGTGGATTATTGA
CAGGGTTGGGGTTTTTTTAAGAAATGAAGGGACAAAGTCAACCAACTGCTGAGTGAGACG
GCAGGGGCAATTGAAGGGAACATGAATACTAGAACATCTGAGATTCTTAACCTGGCCTTG
GAAGGGTATCCGTTTTACGTGTAACCTGGAATGGCTTTATAATGTGCTACCTAATTGTTA
CTCTCATCCTGTATTTTAACTCCTAATTTACCCTTCAGGTCTCAGCTTCTGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 1600..1735, 1940..2024, 3324..3433
1029..1031, 1600..1735, 1940..2024, 3324..3390
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved