Macaca_mulatta Locus RPL10
snOPY snoRNA Orthological Gene Database
Macaca_mulatta RPL10
Macaca_mulatta
RPL10
X
SNORA70
2961..3095
4599
GGAAAACAGGTGCGCTCAAGCAGGATTCCCTCCTGTCCTTCCTGTCAAAGGACGGGAAG
TTACCCCACCGCGCCCCACCTGCAGATGGTGGACAGACACCTACAGACGCCACTTCCCCC
AGGACGCCCGCCCGCTCTGCGCACCTCTCCCTGGATGCTGCTCCGTGGGCGGGTTGGGGC
GGCCCTGCTTCCCCACGACCCCTAGACGGGCCCCGAGGCACTCTGCGCACAGTGGAGTGG
GAAGGGCGAGGCGAGGTAGTGCCCAGGCGAGAGCGGCTCATGGGAGGCGGCGCCCGAGAC
GCAGTTGGCCAGGACGGTGCGGGTCAGGGTGGGCGGAGCGGGGCCAGTGATGCCCCCGGG
TCTCCCAGGCCATGAATCTCTGTGGAGACTTCTCCTCGACCTCTTCCCCGCGGCAATGTG
CGAATTCTGGGTCTCCAGGAAACGGGGATACGGGGCATGGCTCCCAGCAAGGCCTGGTCC
AGCTTCTCCGGTAGGGGAATGGGTCTCCCGCTCCGGCCTCCCGGGTTGACAAAGGAACGC
GGGCCCAGGTCCCTATAAGGCGCTTCACCGCCGGGGCCTCTAGCCTAGAAGGAGGCAGGG
AGCGCATGTCCGGGACCCGCGCAAGCTCGGGGACACTCTCGCGGTCGCCGGGAGGCCCAC
CCAGGGTGCTTTCCTTTTTCCCCTCTCAGAAATATACGTCTGTCACAGTTAAGAGCAAAG
CCTAGGGCAAGAGTTCTACGCCCAAGATGGCCAGCCGGAAGCGGGCTTCTCGCGACCATG
TGGCGAAGCCCCATTCGTCAGCTGGCCGCCCGCGGCCCCGGTACCCGGCCACCTCTCTGA
TCTGCGCATAAGCTGGGCTACGCCTGGGCGCAGGCGCTAAGAGCGGCTGCGTCTATGGTC
ATGACGTCTGACAGAGCGTCCACCCGCCTTCGCCAGGACTCTATGGTTCTTACGAGCGCA
GAGAGACCGCCTATATAAGGCATGCGCAGGCGTGGGAGCGCCCCTTTCCCTTCGGCGCGG
TGAGTAAGCGCGGTTGTAGTCTCTTGCAGTGCCATTGCTGGTTCTCACCCCTTTTAGGTC
TGTTCTCGTCTTCCGTTCCGACTCTCTCTCTCTCTCGTTGCAGCCACTGAAGATCCTGGT
GTCGCCATGGGCCGCCGCCCCGCCCGTTGGTGAGTCTTGACTCGGTGTATTTTCACTGCT
GGGAAACGGGAGGGGAAAGAAGTGCCTGTGGCCGCTGAAAACAGCTGTGGGGTGGAGCGT
CCCCCGTGCGGCGGCCTTGTCTTGGGAACTGATCCTATGTTTTACATCTCCCAGTTCTTT
TTTAGTCTTCAATATTACTGTTTGTTCCTTCGTTCCCGTGTCGGTGTGGAAGCGACTGTT
CCCTCATATATCTCTCCCTGTGTCCTGTAAGCTCACCGCATTTTCGGACGCTCGATGCTC
TCTTGGGGCCTTTGTGTGCGTTCTCTGTCTTATTTCCGGGCGACGTGCCGCCTGCCTTGT
CGGACTTGAAGGGCAGTCCGGGAAAAACGGGTGCGGCCGCCTCCTGTGTCCTACAGGGGG
CGCCAGACGCCTTTCCACTCGACTCGGAGGTGGATTTAGTGCCACGTGCCCGAAAGTCTT
AAATTGGGTGATCTGAGCTGTGCAGTGATAATGCGGCGATTTTGTAGTATGCAGTGTCTT
GAAGAGATAATTTTTAACCAGGAAAGTTTGTTGCGAAGTGTTTATAGGAAGCGTAAGACA
AAGTAACGGAAGATGGTGGCGGTTGTGTTTCTAGTTTTGGGTGTTCTCTGTGTTGCAGCA
GCCAAGTGTTGCTTTGTAGTTTATTTCCCCAAATGCAAACGGTTTAGAAGTGGACGTGCA
TTCCCCACCCTTTTCCTGTCCCTCTTTTGGGTTGTTCCTTGAGGGGCAAAGTCCCTGTTG
GGCTTTATGTGAACCTCACCTAACCTGTGTTTTTTCACTCCCCTGCAGTTACCGGTATTG
TAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAA
GGGCCCCTGCACTGGCTTGGCTCTACTGACTCAGCGTCCGTCTGTGACACCCCCTGCACA
CTTGCCCAATCCTTTTTTAGATGCCAAGATTCGCATCTTTGACCTGGGGCGGAAGAAGGC
AAAAGTGGATGAGTTTCCGCTCTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTC
CTCTGAAGGTAAGGCAGGATTCTTTGTTCGTCACCCCCAGTCCTTCGTCTTTGCTCCCTC
AACCCCATCCATGTACACTGCACTGGAATTGGGAGTTAATGAAACATAAGCCTTTTTACA
AAACCCAGCCAACACATTTCCCCTGAGCTGGAGAAGGTCATGGTGAATGTTTCTCTACTA
TCGTATTTCACTTTGGTGCTTTCTTTCCCCCTACCTAGCCCTGGAGGCTGCCCGAATTTG
TGCCAATAAGTACATGGTAAAAAGTTGTGGCAAGGATGGCTTCCATATCCGGGTGCGGCT
CCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCCGACAGGTG
AGCTTGGTCTGGGCCTTTTAAGGCAGTTTTCCCATAACTTGGAGTCTCTACGTTATTAGG
CTTGCATTAATTCAACGGAGCATAGAGGTACTTGGCCCCAGTGACTCAGCCACTATGGCT
ACTAGAAAAGCCAGGACACAGCTGGCAAGTGATTTTCAGTGGCCACTCAGGACCCTTTCC
TACGTACTGTTGCGGATACAAACAAAGCATGAGTAAGTCTTAGTAAGTAAGCTGTTTCCC
ACAGGTGAGGGGAAACACTTGTGATGGGAGTAGCTTTTCTTTTAGCTTGATGACAACCAT
CTTGCCAGCAAGCAGGTAGTTGAAGCTAGTAGAGGAGCCCAGTGGTGCCTTGCAGGACGC
CTCCATGGTTCTTGAGATGCTCTGCAGCCAATTAAGCCGACTGAGTTCCTTTCCTCATGG
GGGCCCAGTGTGCAATGACTGCAAACAGCAGCTTCCTTGGTAGTGTATGCAGCCTGTTTG
TTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTTCCGATGGACATTCATGTTTC
TAACTTTGCATTACCCCAATGTAGGCTCCAAACGGGCATGCGAGGTGCTTTTGGAAAGCC
CCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCT
GCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCG
CCAGAAGGTACGTATGCTGCAGCCCCCTTCTCCCACCTTTCTTTGCCCCAGGCCTTCTGA
CTCAATTCTTTCCATTGCTCCCTAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAATT
CAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGG
GGTCAAGTACATCCCCAATCGTGGTCCTCTGGACAAATGGCGGGCCCTGCACTCATGAGG
GCTTCCAATATGCTGCCCCCACTTAATACTCACCAATAAATTCTACTTCCTGTCCACCTA
TGTTTTTGTATTTACATTCTTGAGGGAGAAGGAACTTCCTTTGGGAACCTTTGGGTCATT
GCCCTTTCATTTCAGAAACAGGTTGACAGCTCAGCCCTGCTCATGAGGCAGCAAACCCTG
CAAAGGGCTAGGACTGGTGGCCTTATGTCAGTTGTCTACTCTGGAGCTTGACTTGGACCT
CCCCAGGTCCTAGGCAGTAGGTTGAAAAGCATTGAAGTGCTTTTCATGAAGTACAGCTGC
AGCAAAGCCTTGCAATCCCAGGCTGGGGTCAGCCTACGGTTGTGTTGCTTATTACAACAC
ATGGGAACCAAGAGGGGCTTGTGGGCTAGAGGCTGACCAGCAGTGCCCCGACCAGCATCA
GCATTTATTTAGCAAGGGTAGGTGTGGATCGCATTGGGCGTGGTCTCACCCATCTGGTTT
AGCCAGTCCTCCTTGGTGGGAATCATTCTGGGATTTGCACTTTTCCTATCTCTAGCAATC
TCCTGAGCCCCATGCACTAACCTCTCTGAGAGCCTGCATTCCCAGGGCCCTCACCACCTG
ACCAAAGGTCTGGGCTAACCTTTGGTCCTTTGTAACAAAAAGACCTCAGAACAGGCACGT
GTGGCATGGTTTGACCTGGGAATCCCAGATGTCTGACCTGAACTATCGCTAGATAGAACA
GCGCTAGCTTTTGGGGGAGTAGCAAAATTGAGAGGTGTGCTAGGTGGGTGGCCTGAGCAT
CTGTATCCAGGGACAGAACTCCAAAGGCTTTTGGTCCCAGAGCTGGAATATGTTGGCCCC
AGCCCCCAGCCTGTGGCTCCCAAGAGGCCTCTGGTCTTTTGTAATCTCAATTTATAGCCA
TTTGTAAGGTTTTTAATTACCTTTATTTTGCCAAACATACCTGAGAATACCTTTTATTTA
TTTATTTTTTACCTTGGGGTGATGGTTCCAAACCATAAATGTGATTATAGTTAACACATG
GCCTTTCTATCATCCCAGTCAGTGTTTTTCCTGAGCTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1168, 1968..2026, 2120..2227, 2438..2576, 3144..3306, 3385..3599
1146..1168, 1968..2026, 2120..2227, 2438..2576, 3144..3306, 3385..3534
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved