Macaca_mulatta Locus KIAA0515
snOPY snoRNA Orthological Gene Database
Macaca_mulatta KIAA0515
Macaca_mulatta
KIAA0515
15
SNORD62, SNORD62
1587..1672, 6281..6366
14932
GTGGATATGGGGGTGACTCTCTGCAGACTTGTGTGGAGGAAACTGATGGAGGCAGCCAT
CTCAAGGAGATCAGTCGTGGTCTTGGCTGCCATCAGTTTCATCTGGGTGGTCTTGGGTAC
ATGTGGCCAATACTGAAGATGCATTTGGACAATTCATAGATGCTGCTGGGCACTGTAGGT
GCTTTTGGGCAAAGCCACAGATGGGTTTGGGCAAGTCATAGATGGCATTTGGACAAGCCT
TGAGTGTGTTCAGGCGAGCCATGGGTGGGTTTGGGCAAAGCCGTCTCTGTGCCTATTTGT
GTTCCATGGTTTCTTTTTCCTCCTCTCCAGGCAGGGTTAACACAGAGTATCCCCATCCTG
CGGCGGGACCATCACATCCAGAGGGCCATTGGTCTCTCCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCTCCAGGCGGCGCTGGCTCAGGCATCCAGCCTCCATCCTCTGTGGGTG
CCTCCAGCGGGGTCAACTACAGCTCCTTCGGTGGAGTGTCCATGCCACCCATGCCTGTGG
CCTCTGTAGCACCTTCTGCTTCTATGCCAGGTATCTCATCCCCTGAGCCAGGCCTTGGGG
TCCTTCTCCATTTATTGTCAAGAGAAATGGATTAACAGCCCCGAACACCACCTCCTGGCC
TTGTCTGAAGTAGCAGGTAGAAGTAGCAACTTGTTTTTAGGCCGAGTGGCCACAGCGCCC
TGTGCTGCAGGTAGTGTGCACGCTCTGCTTCCCCGTGCTGGGAAACAGAACTGGGGCGAC
AGCGAGGCACTCCTGCCTCCTGGTGAGAGGAGCGGGCAAAGGCTTGGCTTTGAGTCAGAC
CTGGGTTACGTGCTGGAGCTGTGCTGCCTCGGCTGGTGATCAGCTCTCGCTGAGCCACAG
CGTCCTCCTCTCTTAAATGAAACGGGGGGCGATGACATTGCTCCATGAGGTGGCCACACC
CGTGAAGCCAGGTCTTACCTGGAAAGGGCTTTGTATCAACAGAGCCCTTAGTCACTGGCA
GCTGTTTTTGTCCTGACTGCTACCATCCTTGTCATGTGTCGACGTCCCCAAGGGAAAGCG
TGGGGGTTTTGAGGGCGCAGCTGCCAGTCTCAGTGATGTAATCCCAATAGATCCTTCTGA
CCCTCCACTGTGGACTCAATAGCAGGGAGATGAAGAGGACAGTGACTGAGAGACCAAGGC
AGCCCTGGTTAAAGTAGAATGTCCCTTCGAGTGTCTGGGGCAGTTGATGAGTGGGAGGTG
GGAAGGGTAGGCCAGAGCCCACCTGCCTCCTCCCACCTCCTAGGTCTGACGCTGCATCCT
CCCTGGGTTCCCTGAGGTGTGTGCCAGGCGTGTTGTGAGCAGGCGCGTGCTTCAGGCACA
CAGGGAACCGAGCAGCCTCTGTACACATGCCCTTGTCCGTCTGCACTGACTCTCCTGGGT
AGAGCAGACCTGTAGACTTGTCGCCCTCAGGGACATCCAGAAGTAGTGAGGCTTGATGTT
CTTCTACCTCCCTTCTGCCGCTCTGTTTCTAGGCAGCCACCTCCCGCCCCTGTACCTGGA
TGGCCATGTGTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATGTTCTTAACTGCTGTATTGTTTGGTTTTCAAGATTTTGGTTCCTGTATAACTGGGT
CAGACTGCATGTATCTTTGTTTTTGTACGTCGTTAAATTCAGCGTTATGTTTCTGGGACT
CACCGCTGTTGATGTATGTGCTAGAATCCATTTTTGTTGCCGTATAGAATTCCAGGGTAG
GGAGATGCTGCGGTTTGGGGCTGCTACCAGTTTTTCATTATAGGCTTTATCCCAATAGCA
AGGGAAGCCCAGGAATGACATGCTGGCATTTGAATTTTGGGCGGTGTTCCAGCAGCCATG
TGGAGAGGGGCAGGGGAGGTGGGAGGGGAGGAATCACCTGGATGGGCCTTGCGGTTACCT
CCACCACCCCGTTTTCCCGTTCACAGGCCGCCGCTGCCCAGCAGATCCCTATCTCCCTTC
ACACATCTCTGCAGGCACAAGCTCAGCTTGGACTGAGGGGTGGGCTTCCTGTGTCCCAGT
CCCAGGAGATCTTCAGCTCCTTACAGCCCTTCAGGTGAGCTCAGGTACCAGCTTGTGGAG
CTGGCAGCTCACAGCCAGGGCCTCAGCCCTGTGTGCAGCCTTTGTCCTGTGGCTGTTTGG
TGCTTCTCTGCTTTGGGGCAGCGGGGTGGGGAGGGGTGGGGCTTTGCTCTGGATCACTCT
TCAGTCCGTTGTTAACTGTGCTTTAGGAGAGGCCTGGGGTGAGCTGATATGTGGCAGGCC
TTGTTTTGCTTTTCCATGTCATCTTGCCTCCTTCCCTTGCTCCTTCCTCCTTCTCTCCCC
TTGACTCCCTGCCTCCTCCCCACCGCGGGCTGCTCCGTCAGTGTGGCTGCCAGTCATTGT
GGCTGATGTCCTGTGCCTCGTACAGCTTGGATGTGTTCACTTGTTTAATCCAGCAGCATC
AGCGCCATCTAAGAGCTTGTTCTCAGGCCCCATCCTGGACCCTCTGAGTCGCGCTCTGGG
AGTGGGGCCGGGGATCTGTGTTTTAGCAAGCTCTCTGGGGGATCTCTGAGGGGTGGGACG
AGATCCACAGCTGGACTCATCGACCTGATCCTGACCATCTGTCTGGCTTTTGCAGATCTC
AGGTGTACATGCACCCCAGCCTGTCACCGCCCAGCACCATGATCCTCTCTGGGGGCACAG
CCTTGAAGCCTCCGTACTCTGCGTTCCCAGGCATGCAGCCCTTGGAGATGGTGAAGCCGC
AGTCTGGCTCACCCTACCAGCCCATGAGCGGGAACCAAGCCCTGGTCTATGAGGGCCAGC
TCGGCCAGGCTGCAGGCCTGGGTGCCTCCCAGATGTTGGACTCCCAGCTCCCACAGGTCA
GGAATTCAGTCACTCCACCCAAAGCCCTAGGCTGCTTTCCTTCATGACCTTGCCTTTTCT
TTCCGCCCGCCTCAGTGTGTGCTGGCCTATCATGCTGTTCGTTGGTAGCCACCGTGCCCG
CTCCTCAGTGTGCGGGAAATCAGCCTCTTCTGAGTAGCCCCATCACCTTTTTTTTTCTTT
TGGACAGAGTCTGTCACCTAGGCTGGAGTGCAGTGGTATCATCTCGGCTCACTACAACCT
CTGCCTCCCGCATTCAAGCGATGCTTCTTCCTCAGCCTCCTGAGTAGCTGGGACTACAAG
CGTGTGCCACCGCGCCTGGCTAATTTTTGTATTAGTAGAGATGGGGTTTCACCATGTTGG
CCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATCTGCCCGCCTTGGCCTCCCAAAGGGC
TGGGATACAGGCGTGAGCCACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTTCACTTGGGC
CCCTGCTCTGTGCAGTTCTCTCTAGGCTTGGCCGCTCCCAGTAGCTGTGGCTCTCGCATA
ATCTCAACTTTCAGCGTCCCTCTCAGTTGTCACCTCTGGCTTTTTCAACTCCCTCTAGTG
ACCCAACTCGAAAATTCTTTTTTTTTTTTTTGAGATGGAGTTTCACTCTATCACCCAGAC
TAGAGTGCAGTGGCTGGCACAGTCTCGGCTCACTGCAACCTCTGTCTCCTGGGTTCAAGC
GATTCTCGTGCCTCAGCCTCCCGAGTAGCTGAGATTACAGGCGCCTACCACCCACCGGCT
AATTTTTGTATATTTAGTAGAGATGGGATTTCACCATGTCAGCGAGGCTAGTCTCGAACT
CCTGACCTCAAGTGATCCACCCACCTTAGCCTCTCAAAGTGCTGGGATTACAGGTGTGAG
CCACCACGCCCAGTCTCCACCACCCACGTTTTTGTCATTCTCCCACTTGGCTTGGCTTCT
TCCTCCCCATCAGCAGACCCGTTGAGCCACGTGTCCTTTGCATTTCATCCAAGCTGTGGC
TCTGAGTCAACCACCACCCTCCTAGCAGCTTTTCAGACTTGCATCTTGCCCCTCACTGCC
TCCCATCTGTGATCTCCCTTTCTGTGTCACCCAGGAAACAGAAGCAGTGACAGTCTCCAA
GCCCCTGTGGCCACATCCCTGCCTGGGTGCTGCCTGTGCCCCTGGGGGGCCCCACCCCAG
CAAGTCTCCCTCCCTTTCATGCATCAGATGGCCCTTCCTGTCAGTACACAGACGAGTTGC
AGTGCTGACCCCGTAATCCCGCCCCCCACAGCCCTTGAAGCACTGTCTTCACCCAGTTAC
CAGGCCATCACTCCTGGCTTTCCTGCTGCCTCAGACTTCCTCCTCAGTCTCCTTTGCTGT
CCCCTCTCCTTCCCAGTCCGTAACAGTTGGCATGCCCCTGGGCCCTGCTTTGGGCGTCTT
TTAAGAGTCATGGCTCTAAATTCCTCCATCTTCTCCTCACTCCCAAATGGACATCTTCAG
CTCAGATCTGTCCTTGGAATTGAATGTGAAATCCAATGAACTTTCCAGCACCTCTCCTGT
GGTCTCATGACATCTCAAGACTCATCATATCCAAAACTCGATTTTCCTCCCCGTCCTTCT
GCTTGTCCAGTCCATGTCCTCTTTTGCTCCCTTCTCCCCTCACCTCACCCGACCCTTCAG
CGGGCCTGGCTTTAAAAGCATTCAGAATCCAGCTGTGTCTCATCCCCTCCACCCCCGCTG
CACGCTGTCCAGCTCCTGTGGGGGCTCCTACCTGGCCTCCCTGCAAGTCAGATCATACCC
CAAGTCAGCACTCTAAATGGCAGCATGTCCCCATCATCTTCATCCTGCACCATGTTGGTG
CTCCAAGGAGCATGGTGTTTTGCGGCTCTGGCCACTACACGTCTCAGTGATGTAATTCCA
ATAGATCCTTCTGACCCTCCACTGTGGACTCAATAGCAGGGAGATGAAGAGGACAGTGAC
TGAGAGACCAAACGTGGCCCAGCCCTGCTACCCCATTGTGTCCCCCTGTCCTTAAGAGTC
TCCAGGCCCACATCTCCCCCTCACCTATCTTGTTCTAGTTAGTTAGGCCCTGCAGCCACC
CTGTTCTCCTGTCACAGCATGCTTCAAAGAACCCCCACAGCCCAGAATCCAGCCAGTCTT
GTTTTTACCACCACTTGATGCAAAACAGTGAGAGTCTTGAATGTTTGTGCTGTACAGAGG
AATGCAGAGATACACGTCTGGTGCGGCTTTCATCTTTTGGGATTTGGCTTGGCCATTACT
TCTGACTTTCCTCACTCGTCCTCCCCTTGCCCACCCCGCCCTGTGTGCACCCACAGATCT
GGTGTGCACACACAGATCCTGTGCCACTTTGCACCCTGAGTGTCCTGCAGCTGTGTCCAG
CGTGTGACATGCCACCCTGGCAGTGTGCAGGCCCATGTCGGACAGGGCCCTGCCGCTTCC
CCAGCACCTCGTATGCTTTTAGTAAGCACTTGCTGGACAAAGGCAGAAAGGGCTGAAGAT
AGACGCAGCCCTTAGCAGAGATGTGGATGAGACACACTTAACGCTGTTAGCTCCTGTGCC
TGCAGCCAGCTTCGTCTTGCCCGTTTTCTCACCACCTACTCCATTCCAGCAAGAAGACGT
GCCCCTGCCATCGAAGGTGTGAAATCCTGGGCGATGTCTGCTGTGCTACAGTAGAAATCA
GAGCGTGTCCTGCTGTGTGCAGGCTTTGCTTTAGTTCTTCTGAAGTGTATGAATTTGAAG
TACATGTGCAGTCGCTCTTTGGTGCGTGTTTGGGGTTTCTCCGTAGCATCGGTCGGTCCC
CCTTCTGACTGTCGTTGTCACCCAACAGCTGACCATGCCACTGCCTCGGTACGGCTCGGG
GCAGCAGCCGTTGATCCTGCCCCAGTCCATTCAGCTGCCGCCTGGGCAGAGCCTCTCTGT
TGGGGCCCCCCGAAGGATTCCTCCGCCCGGGTCCCAGCCGCCAGTCCTGAACACCAGCAG
AGAGGTAAGGGGACCCATCTGCCTCTGACCCTAGGGAGGGGACCTTGTGTCACCAACCTT
TTCTAGCAAGCTAAGTACCCCTGTGTGGTAGAAAGAGCCAGTGGCCTGGGTGTGTGCAGG
ACTGTCGGGGCAGAAAGGAAGGTGACCGTGTGTGGGGCCATCACACAGGCAGGTCCTGGG
GACTCTGAAGTTGTCGACGGCTGAGGACCAGGAACCAGCATTCCTCCCCGGCTCCCCAGG
AGGCCCTGCTATGGACGGCCATGCTTCATTGGCTCTCCCACCTCACTTTTAAAAAAGAAC
AAAATATTGTGATGGTTCTTGCTTTCTAAGAAGCAGCCCTCTTGAGTCTGGTTTGGAGGG
GAGGGGCTTGCAGATTCCTCCAGAACAGGGGTGCCCAGCCCCTGGGCTGCAGAGCTGTCC
TGGTCTGTGGGAGAATTGTCTTCCATGAAACTGGGCCCTGGTGCCAAAAACCACTGCTCT
AGAAGATGCCTCCCTGGGAATTCGCACGGCCCTCACCGCCTCTGCCCTGGGTTGTTCAGT
GAGTCTGTGTGGTCCAGCTGTGTCCAGGGCCTCAAATGACAACTTGTTGCTGCTTGGTCT
CTCTAGCCCTCTCAGATGGAGATGAAAGGCTTCCACTTTGCCGACAGTAAACAGAATGTC
CCTTCAGGAGGCCCCGTGCCATCGCCACAGACCTACAGGTAAAACCACTCCCTGGGGACT
GTGTGCTATGAGCTGAGCAGTTGCCAGAGCCGTGGCCCGGTGGCTCAGAAGAATCTGTGG
GCCTGGGGAGAGCCACCAGAGACCTGGTCCCTCTGTGGGCCACGTGTCACTGTGGTGGTT
CGGCACGGGGATGCACTTGTGTTGCAGTTAAACGTGGGGGAGTGAGGAATCAGGAGAGTG
GTTTCGGCTTTAATCATTATAATAAATAAGATGCTCTGGATTGGGGAGCTTCCTGGAAAG
GTAGGAAAAGGAACGGCTGACATTTAGTAGGCGTCAGGACTGACGTGACTTCCCATCAGA
TCCGAAAACAGGACCCACTGGCCACAGGGCTGCATCCTGCCTGGCAAGGGGAGAAGCATG
GCCTTTCCCAGCGTCTCTGTCCTCGGACTTGCCCTATGACCCCTGCCAGGGGACTTTTTA
TTGCTGGGCTTGTGGGGCCATTCCTTCCACACTACAAACCAGCACCCTCTTTTTGCTTCC
TTTGTGTCTGTCTCCACCTCCAGCAACTGTCTCAGGGTCCCCTTAGCTGGATACTCAGGT
GGCTCTGTCGGATGCCAGCGAGAGCCTCTGGTCCACTGCCGTTTCTGCCCGTGCTGGTGT
GTGAAGGCAGCATGCGCTGGCCCTGGGCTCCGAGGGCTTGTACAGTCCACCCTTGTTACA
TGTGGGAGAGTCCTGAGACCCCTTTGTGTTTATAAATGAGTGAAACAGACCTGCCTGACC
CATGGTGCCCTGTGAGGTTAATACCATCGCTGCAGGCGCCACGAGGTGTCCCCATGACTA
CACAGGTCCTTGCAGACCCGAGGAGTGCTCTGCAAGCCGGGCCCCCATGGTCTGCAGGTT
GCTCCGGCTGCGCCCCCTCTGGCCCGCTGCCCTTTGCCTGTCTTCCGTCACGGCATTCCA
CTCTTGTACCTTCATTTCCAGAGAAAGGGGTTTTTGTGAATTTTCCTCCCATTCTTTCTT
TTCTGTTCTTATTTTCACTCTCCTGGCTTCATTTATTTCTGTTTTTAGTACATTTTGTTT
TCCTACCATGTCTGTCATATAGACCAAAACATCAGGACTGTGTGAAAAAGATAGCTGGAC
AGTACCGACCATGGAGCGGAACTGGAAGGAGGAAGGCAGCTGCAGGTCTCAGCAGACGCT
GTCCTGCTGCTGCCACAAGCAGATTCCAGAAGCCTCAAAAAGGCAAAACCCAGAGAACAG
AGCCTGACAGGACAAGAGTCGCCTGTGTCTATGTAGTTGTAGGAATGAATGGCAGCAGAT
TATTCTTTGGAGCATATTTAGACAGTGGAAGCCTTAAACAAGTAGCTTTGTTTCTATGGT
GTTTTAGGGGGGTTGGGGAATTGCTATAATTGTGTAAAGCAGTGTTTCCCAAAGTGTTCT
GGAAATAGAGCTGCCGAGATGTGCGCTGCAAAAACAAGGGTTCCCTGGTCAGGTCCTTGG
GGGAGTGCTGTCCCGGGTTGGCCTGCTAGGGAGGGCATTCACCACACAGAGGCTGAGCGG
CCCTAGGTTGAGAGTCCTGTTGAACTCTGCACACGGCACTTAGGCTTTTTGACCGCAGAC
TTGTTTTCCACGTAGCACCCACAACATCCCTGGGAACTAACTAGTGGTCATTGGGACACA
TTTAGAAGTATGTTGTACATTTTGGTTCCCCCACCCCTTCTTCTAAAAAGTTAAGACTAG
AACAATACTCGGCACAGTTCTGGCTCAGTGTCAGGCTTCTAGGCCTTTTGTCTGGGGCAC
TGCATCATGTTGGTCCAGACCCTGAGACAGCCAGTGTCGCTTTCTGCACAGCAGGACAGC
CGTTCCCACCTGTACAGGGCCTGGGCCTCCCTCTCTTGTGATGCGTCTCCTTGAGCTCTG
TCCTGGAGGTGCTGGGGTGGTCAGTGACAGTCACCCCCTCACCCTTCTGCGTTCTGGGCT
GTCTTAGGTCTATGGTTGTTTTCCATCCGAGAGATCCACAGACCGTCCCGAGCACGCGCC
TCTGGCCACAGGCCCTTCCTTCCTTGTGCCTCCTCCGTGTGCTAGGCTTTGACTCCATTT
CTGTGGTGACACGTTGTGTATTCTCAACCCCTGCCTTTGGTTTTTTCAGGCCTAGCTCTG
CTAGCCCCAGTGGGAAGCCCTCTGGATCAGCAGTTAACATGGGCTCTGTGCAGGGACACT
ACGTGCAACAGGTAGAAGATGGCTTTCCAGACCCTTCAGCCCTGGACACTTAGGCCTGTC
TCCAAGCGCCAAAAGAGAAGGGACTGTCCAACCTATCTGAGCGCTCCTTGTCTAAAGAGA
GCCATGCCCTAGCGGTTAGAGCACGGAACCAGGAGCTGGGCCGTCCGCGTCCCTCCTGGC
GAAGGCATTTCTCCTCTTGACGGGCGTCTGGATCCTTCCTTGTCCTGCAGAGAAGGGAGG
ATGCCGATTCCTCTGAGGAGGTGGTGCTGGAAGGTGGACCAGCCCTGGCAGGTCGGGGCT
GAGGTGCCCTGGGAGACTCGGTTAGGTTTGGGGGTCGGCTCTAGGAGCCCGGGTGCGCGC
GCTGGTTCTGGTCAGTGGTGTGTCTCGTTTTTGTCTTGGCCGGGTGGGAGCACAGGTGAA
GTTAATTTTACCCATATAATGAAAAGGACATCGCAGTGTATTTTCCTGCAGGCACTATTC
TCTTCTCTGTTCTCTAAAACATGCTGGGGCTCAGAGCTTAGGCCCCTCAGACCTGGGTTT
TTAATCAGTCACTGTGCCTGGCTGGTAGAGGTGGGCAGTGATTGCTCTCATTGGTTCCCT
TGGGGGTCATGAGAGTTGTGTGGAATGAGCTTCTAAAGCTTTCTTCCAGAGTTCAGACCT
GGTGGGGGGCAGATGCGCTGACTGCTCTGTGACTTCCCCCCGCCACTCCCTGTGTAGAGC
CACAGACCAGGGGAGCCCTGACTAGGAATGGGGCCCCAGGAAGAGGTTACAGAGTGGGAG
TGGTAGGGGGTTTGGCTGAATCGCGGCCAGAGATCTGTGGGGCAAGTCTGCCTAGGGCCC
CAGCAGACAGTCGGGGGCTCCGAGACGTGCAGGGGGCACTTGGATCTACTCGAAGGGGCT
TTTTTGCCTGCGGGGCAGGAGGTGCACTGATTTGAAAAGGTTCTTCCAGTTGGCCTTGGG
ACCGGAACTGCTTCCGCCCTGGGATGTGCCATGGCGGAATTCTTTGTGGAGGACCCGGTG
TCTTCCTGCCTCTCCGAATCACTGCACTCGGGGCTCATGGGAGGGAGCAGAGAGGGCACT
CGCGCCACTTTCCTTACTAGGAGGAGGGTTTCTAAGTCTGGTCCTTCAACCAAGGGACGG
ATGACTTACGGGAGCTTTCCCTGCATCTCAGGAGCAGGAAGGGAGTGGTGGGAACTGTGT
GTCCAAACACGCTTCAGCGCCAGGGTCACTTTGTTTTCCCATTCATCTGTCCAAAGGCAA
AACAACGAGTGGATGAGAAACCCAGCCTGGGAGCCGTGAAGCTGCAGGAGGCCCCCTCGG
CTGCCTCCCAGATGAAGCGAACCGGAGCGATCAAGCCTCGGGCTGTCAAAGTGGAGGAGA
GTAAGGCCTGATGGTGCCTGGCTGCCACCTCATGTCGCCCCACTGGGGATGGTGCCGCCA
TGCGGCCTTGACATAGCCGACACTCGGGAGCCTCACCAGATCCACTGTCCAAATGCCTGG
CCCGGACTGAGAGACCTCCCTCCTCTCCACTCCCGAAAGCTCCGTTGTCAACCAGCTTGC
ACCCGTGGATATATGGCAATGACCCGCTTGCTTTGATATGAAACAAAAAAGCAAACGACA
CCTTCATCCCATCTGCTCCCACCGTGACCGTGGAGTGACGCCTCCCGTGCAGTGCAGATC
TGCCCTCCCTGCCTCCTCCCTGTCCTGCCGCACAGCCAGGGCGCCTTCTCAGCAGTGCTT
CCGGCCCAGCCGCCCAGTCCTAGGCACAGTGGTTTGGCAGCAGGGTCATTTTACTTTGAG
GCTTTTTGTTTTAAAATGTAGCCAAGGTTTTTACAAAGGGGAAAGGAAAAGAAAACAGAA
ACGCAAGCTCCCTGTGTATAGCTGAACTTTTATATGTTTCTCGCCAGCCCCTCTCCTCCC
TCCCATCTCTAGCCTCTGTCCAGTTTAATTTGATACGTCACTGCAGTACCTTAAGAGGTG
ACTCTTAAGAATGCATCCCCTCCTGATTCCTCAGCTGGTTCATCTTTGAGGTTATTTGCA
AAAAGAAATGGAGGTTCTCGAGGGCACCCGTTGCGAGCACTCTGGTGCCTGGCTCCCCGC
CTAGGAAGCAATGGGGTGCGCAGAGCAGCAGGCAGGTGGCGGCGGGGGGGTCACAGTTGG
GTTCCAGCTCCTGGCCTGATGAGCCCAGGGTGCCTACAGGCAGCCCATGAACTTGATGAC
GGTTTTAGCATGAGAATCACACAGGGTCCCTGTCCTGAGCTGCTCTGAAGCCGGTGGATG
TGCTGAGCACTAGAGACCAGTCATGGAGGTGGCTGCTGGTGGCTCCCAGGCTGGCCCAGA
TGGGATGAGCTGAGACACCACAGGCCCATCCCAGGCCCCGTGCCCTCTGCTTCTGGGGCT
CCACACCCTGCCCCTCAGGGGCGCTGTGTTTCACGCACTCTTTCCTTGAAGCCTTCTGTA
ACCTGTTGTTTTCCTTCCTTCCTCTTCTGGAGCCTGCTGCTTTCTCTGGACCCGTCTCCA
CCTCCCACACAGCTCGTCGTGAACACCACTTGGTGACGGAGGAGTGGACCTGCGTGTGGT
CCCCAAGTGAGGCCGCTGGGAGTTTGTCCTTTTCCTCCTTTGCTTCACTCCCAGCAGCAG
ACCCAGGTTGTCAGGACAGGAGGGCCTGAGCTAAGCAGCAGGCATCAGTCTCATTTGTCT
TCAGATGACCGGGGCGGGGGGCAGGGTGAGGCTGGGTGGAGGGCTGACCAAGGTCCAGAG
GGCCTGCGCAGTCTCTGCAGGGGCAGCTTCTCCAGCCAGAGGCTTGTGTGAGCCATCGTG
TGCTGGGCTTGTCGTTGTTAAATAAGAAACAAGGAAATCACTCCAGATTCTGTCATTCCA
AGGAAAGGGAAGGGGACAGTTCAAGTTTCTTAGCTGTTCTTAGGGGTCACTGAGCGTCTA
CCTGTCCTTCCAGAGGAGGCCAGCTCAGAACACCGTGAGGAGAGGGCCAGGGATGCACCG
CCCAGAGGCTGCCCTCGGCATCTCATGGGTGCAGGACAGCGCTCGGGCTTGGGCTCTAAG
CTCTGTGTCTAGTGTAGAACATGGGGAAGGAGCATCTTAGGAACTGCTAAAGTAACTTCT
TACTGCTCTCACAATTCTAAGGAAGTGGGAGAACGGCCTCCTACAAACAGTGCCCACCCC
AGAGCTGCCTGGGAAGGAGCAGTTTTACTGAAAGCTGCTTTACTGTTCACCTGCATCTTT
CAGCAGCTCCCCTCCTGCCCTCACCTGGTCTTTTCCCTCTTCATCCAGAGTCTTTACGCT
GGAGTCCTTTCCCCAGGGGCTGTCCACCTGACAGTTCCGGGCATTCCCTACCTGAGCTGC
GTGTCTGCTTTCCCTTCTCCCACTGCAAGCGGCTGCTTGTGGGGCCTGGGATGAGCCCTC
TTTGTCCCTATCCGCCCCCCTTGCCAAGCCATTCCTGGGTGAGTCCAGGCCTGCGGGAGC
CACACATTCATCTCCACCTGGACACTTGAGCCACATGGCGAGACCCCTCCCACCCGACGC
GGTGGTGCGTACGATTTGTCGAAAGAAAAAGCCTCCCGGATGCTGTTAAAAAGATACACC
CTTCAGGTGAACCTGGCATCAGACCCACAGTACTTGCTGTTTGAGAAAAAATAAAAACAA
AAAGGTCACCTGTTCTCCAGCCCTTTTCTCTTACCCGGTATTTCCTTCCTTCCTTCTCCC
CGACCCCAAATAAAAAAACAAAAAACACTAGAATTTATTTATATGTATTGATGTTGTAGG
TCTAGATAAAAAAAAAAAAGAAGTAAATGTTTCACTGCTCTATTTATATATAATGTCTGA
ATTAATTCTGTGCAGGAAAGGCCAGGAAATTGCATGTGAAGTTCGGTGCAGTCACCACCT
CTGTGTGACCTGAGCTGCAGTCTCTTCGCTGAGATGCAGATTTTAAATGAGACTGGGGGC
TGAGGGCAGGCCTCAGGCCTCCCAGCGCCCCAACCCCTCCTTGGTCTGATTAAATGCAGT
TCTTAGTGCAGAGACGTTTTAAGGTGCAATATATCTCTTCCTTTCACGTGGTTTTAGAGC
CAAGCTCAAGGTAGTAGGACGTAGGGTCTTATTTTGTTTTCAAACCCCCATCTTCAGAGC
GTAGATACATGCAGAGGCTTCTGCCAGGATACCACGGGGCCTTGGTGGGAACAGGTGGAG
ACCAGCGCTTGCCTTTTCTGCTGCTGAGTGGGGGGTCAGAACCCACTCACTTTTGCCTGC
TCAAGTTGCCCTCTTCCCGATGCTGGCAGCTCTGCCTTTGCCATCGGGGGTGCGGCCCAT
TGCTCAGCAACCAGTGGCCTTGCGGTGGTATTTGTCCACTGTCCGCTAGAGTGGGATGAA
GTCCAGAGTGTGGGTGTGCATCTGAAATGCTCATCCACCCACTGGGGACTTCAATGCCAG
CTGCATTCGGTTTGGTTTTCTTCACTGTTGGCTTCTCCCCCCAGTTTTTTTTTTTTTAAA
CATTTGTATTGTTTTCAAACTTGGAATTCATAGACACTCTGGCTCTAGGTTCCTTAAGGG
GGAAACAAAGGATGACTTTATTTCACATTCAAGAAAATCAGTTCAGTTCCAAAGCTGTGG
TCCTTCCAGCCACTTCTAGGGACACTGGGGTACCTTGTTAAACATTCACATCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 2012..2048, 3025..3213, 3775..4015, 7228..7383, 7986..8077, 11516..13932
1001..1049, 2012..2048, 3025..3213, 3775..4015, 7228..7383, 7986..8077, 11516..11555
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved