Macaca_mulatta Locus HSPA8
snOPY snoRNA Orthological Gene Database
Macaca_mulatta HSPA8
Macaca_mulatta
HSPA8
14
SNORD14, SNORD14, SNORD14
3690..3777, 4124..4210, 4973..5057
6640
GGTGGGAAGGGGCCTAGGGGTCGGGGGTTGAGAGAAGCGGGTTCGCCTTTTTTTCCCCG
GAGGAGTCCAGACACGACCGCGTCCTGAGGCGGTTTTGAGAAGCCGGGCCCCTTACACTT
CTGCGTCGGGGGCTGCCTCCCAGCAGTTCCCGTAGGGAAATGCGGGTGCTGGGGGGGCCT
GCCGAGCTAACCCGCCCCACCCCGCGGCGGCCTGGCGGCTCCCTCGAATCCCAACCCTGG
GTGCCCCTGAGCGAGCAGCCCTAGTAGCACCCTGAAACCGGAACCTTCGCCCACGCCCAT
CGGGGTCAGCCCTTGCCCAAAGCCACGCTATGAAATATAGGTTCGCGAAACCTGGGGCAC
TCAGAGGATCGTCTGGAACATGGAGATGGGGGATGGGAAAAGAGGAATGAGGACGTGTGT
GGGGGAAGGGAGCAACAACCTTCGCAGCCATTTTGTCCTCGCTCCACTTCCGTCTTCTCC
TCCCCGGCTCCCGCGCCCGAACCCCTCCCTTCAGGCCCCGCGCGATTCCTCCCCCAGTTC
TGCGCGGGCCTAGAGCGCGGCAAGCGCCGCTATCATTGGTTGGTTCCAAGTTTTGCCCGC
CCCTCTTCTTCCACCTTTTTCCGCCCCCTCCTGCCCGCGCAAGCTGGGGGCGCATGCGTA
GAGGCGGACGCTCCCCTCCCCCGCCCGGGGTAACTGAGGACTCCCGCGCGCGGGCTGTCT
GCGCCCCACCCTCCCTTTCCCCGGAGCCGTCCGGAGAGCGGGGGCGAGCTTGAAAGTTCC
AGAACGCTGCGGTGAGTGCGTTATCGCGAGGCGGAGCGCGGTGGGGTGGGTGCGGAAGGG
GGCGAGGCCCGAGGAGTGGAGCCGGGCTTGTGATTGGGTCTTGTAAGGGCAGCCTGGCGT
CTATTGGCCGGGGAAGCCGTAATGGCAGGCAGCAGGGGCGGGCCCCTTCTGGAAGGTTCT
GAGATAGGGTATAAGAGGGAGGGTGGCGGGCGGAAACCGGTCTCATTGAACTCGCCTGCA
GCTCCGGGGGCTCCTGTGACTTTTGTCTTTATCGGAGCCAGGCTTACACGCCAGGTAAAG
CTTCTGCTCGAGAGTTGGGTTATGGGTCTGGGAGCGTGCACTTTCCACACGGACCGGTTG
AGCTTGTTGCGGCTTGGAGAGTTCTGAGAATTTTGTCGAGGCGAGTGTGCGGCCGCTTCC
ACCGGCTTGAGGGGCCTCAGTTTTCGGTGGGGTGGCAGCGGCGCTTGGTTGCAGCCGGCA
GGACAGAAATATAGGAGTTGGGCCGCAGCCCCAGGGGAGCCTGGGAGACGCCCGGCGACC
GCGTGGCGGGGGAGGGTTGCCGCATCGCCTACCCTGGCGCGCAGGGAAGTGGAGCGAGGG
TTTTCTTTACCTCGCTTCCTTGTGTAGTCCGGTCCCACCATGGTTCTTCAAAGCCGTACT
TGGCGTGCTTCCAATATGGGGGTGCATTCCGGATCAGTCAAAACCCCAGTTGACTCGGGG
ACACTGGCACCTGGCGAGGGAGATGGGCTAGATAGGGCTCAGTTCCAGGTTAAGACCACG
TGCTCAGCAACGCCCCAGGCCCTCTGGTGGGTGGTTCATCCAGGGTGTGCTTGGCAGCGG
TTGGCACGGCAACCCGGACTGCAGCACTAGTTCTGAACCTTTGGTGTGCTTAAACAAGAG
GTGATGGTCACTACCTCTTGGTAGTGGCTATATCTTTTTCCTGGTTACGCGTTGTTTTAA
GGGATGAGGGAAATACTTTGATTAACTGGATTTTTAAACCGGATTTTTCTTTTTTTCAGC
AACCATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGG
TGTTTTCCAGCACGGAAAAGTAGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCC
AAGCTATGTTGCCTTTACGGACACTGAACGGTTGATCGGTGACGCTGCAAAGAATCAAGT
TGCAATGAACCCCACCAACACAGTTTTTGGTGAGCTACTAATTTTAAGTGACTGAACAAA
TTTAACAGGTCTAGGAAGCAGAAGAGTTTATGAAATGTGAAGGGGGAGCTTTTTGTTTTT
GAAAAATGAGCTGAGACCAAGTCTGTTATAAAACGGGTTTTAGAAACTTTTCAGGCTGAA
AATCTACATAATGTAGGACGTCAAAATTGGAACCTTTGCTACCTATATGGTAGTTGAATT
CACCTACCTATGAACTTCGGCATTTGAGTAATCATTAACTTGGGTTTTATCAGAAGAGGT
ATGAAATTGAAAGTGTTTTCATTTGATACCTTTTACAGATGCCAAACGTCTGATTGGACG
CAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAGCATTGGCCCTTCATGGTGGTGAA
TGATGCTGGCAGGCCCAAGGTCCAAGTAGAATATAAGGGAGAGACCAAAAGCTTCTATCC
AGAGGAGGTATCCTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTATCTTGG
GAAGGTGAGGTTTGTTTTTCAGTATGTTTTTCAGCATTCTGGAGTAGTTAAAAGCCCATT
GACTCCAGTGGGGCACTGGCACCTGGTGAGGGAGGGGAACAGATGGGGCGCAGCTCGGCG
TTAAGACCACGTGCACTGCCCCCAGGCTCTTTGGGAAGCTGGGTCAACACCAGAAACCAG
TGAATCTTGACAATTAGTAATTTACATTTTTGGGGGGGTGCTCCAGCAGTTTTTGTTTCA
CCAGCATTAATCCATTTGCTGGAGTTTGTGTATCTAAGTATAATAGTTTGATCTGTGATT
TCTTCCTTATTCGTAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTATTTTAATGA
CTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAAT
TATTAATGAGCCAACTGCTGCTGCTATTGCTTACGGCTTAGACAAAAAGGTATGTACCAT
TTGTGATGCAAAGTCCAGATTATTTTAAGATTAATTTGATTGTCAGAAATTTAAATGAGA
TTGTTTTCAATGGCAGGTTGGAGCAGAAAGAAACGTGCTTATCTTTGACCTGGGAGGTGG
CACTTTCGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAGTCTACAGC
TGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTTAACCATTTTATTGC
AGAGTTCAAGCGCAAGCATAAGAAGGACATCAGCGAGAACAAGAGAGCTGTAAGACGCCT
TCGTACTGCTTGTGAACGTGCTAAGCGTACGCTCTCTTCCAGCACCCAGGCCAGTATTGA
GATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCCCGATTTGA
AGAATTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCCCTTCGAGA
TGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCTACTCGTAT
CCCCAAGATTCAGAAGCTTCTCCAAGATTTCTTCAACGGAAAAGAACTGAATAAGAGCAT
CAACCCTGATGAAGCTGTTGCTTATGGTGCAGGTAACAAAAGTATCTCAATTAATCCTAA
AGGAAGGCAGGCAGGAGATGAGGAGGTGACTCGCTGTGATGAGTGATTGTTAAACATTCG
TAGTTTCCACCAAAAGCTTGGCTAATGATGGCAACACCTTCCTTGGATGTCTGAGCGAGT
GATAGTGGTTAAAACAGGAGCTATGCACTGGGTTTTTTTGTTTTAACTTTCTAACGTTAA
CTTTTTTTCTTTGCTAGCTGTCCAGGCAGCCATCCTGTCTGGAGACAAGTCTGAAAATGT
TCAAGATTTGTTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTGCTGGTGG
AGTAATGACCGTCCTTATTAAGCGTAATACCACCATTCCTACCAAGCAGACACAGACCTT
CACTACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGGTATGTTTTCTGTACTTTTC
TTGCTTGGCTTACTGATACCAGATAAAGAGAAGTCTGGACTGACTCGCTATGATGATGGA
TTCCAAAACCATTCGTAGTTTCCACCAGAAAGTCTTATGTTGGCCAGTTCCTTCCTTGGA
TGTCTGAGCGACCATTCTTCCTTAGCAGGACTCTAGCACTAGCAGAGATGTGAAGTCTAT
TGTAGTAATTTGTTTTATTCCCTACTAAGGTCTATGAAGGAGAGCGTGCCATGACCAAGG
ATAACAACCTGCTTGGCAAGTTTGAACTCACGGGCATACCTCCTGCACCCCGAGGTGTTC
CTCAGATTGAAGTCACTTTTGACATTGATGCCAATGGTATCCTGAATGTCTCTGCTGTGG
ACAAGAGTACAGGAAAAGAGAATAAGATTACTATCACTAATGACAAGGGTAAGTAAACAC
ACATGGCACTGTCATCTCGTCTTGACAGGGATCATAGTGGTATTTCAATTGAGTTTCTGG
TGCCTCAAGGGCATCTAGCTAAGAGAAACTAGAGTTATACGGGAAATGTAAGGCTTTTTT
ACTTAAAAGACTTAATTTCTTTCCTAGGCCGTTTGAGCAAGGAAGACATTGAACGTATGG
TCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTATCATCCA
AGAATTCACTTGAGTCCTATGCATTCAACATGAAAGCAACTGTCGAAGACGAGAAACTTC
AAGGCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCA
ACTGGCTTGATAAGAATCAGGTTTGTGATTTTCCCCATCCCCCACTCAATGGAAGGAGAG
GGGAAGGGGAAGGGGATGGTAAAACCAAGCTTGAGCTGGATTTCAGTATAGGGTCACAAT
GATGAATGGTCCAAAACATTCGCGGTTTCCACCAGAATTCAAGGTGTTGGCAACTACCTT
CCTTGGATGTCTGAGTGACCCCAAGATGTTAAGAATAAGGCCCTATTTTAATGTTGACAG
TTGGCCCTCTTGTAGGAGTTGGTGTCAGCGACTTAGTATCAGGTTGCATCAGGGTTAGAG
AAAGGTTATTAACGTTACAAGAACTTGTAGTAATTCCTTTTTTCTCTTCCTCCAGACTGC
CGAGAAGGAAGAGTTTGAACATCAGCAGAAAGAGCTGGAGAAAGTTTGCAACCCCATCAT
CACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTCCCTGG
TGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCCACTATTGAAGAGGTTGATTA
AGCCAACCCAAGTATAGGTGTAGCATTGTTCCACACATTTAAAACATTTGAAGGACCTAA
ATTTGTAGCAAATTCTGTGGCAGTTTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGC
ATTCTCAATACTTGAATATGGAACATGCACAGGGGAAGGAAACAACATTGCACTTTATAA
ACACTGTATTGTAAGTGGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACCA
TAAAATTGTTTTGACTCTTTAGTTTCCCAGGTCAGCTGCTGGGAGTAGTAGTCCTAGGTG
ATTATGTGAATCTTACTCACTTTCCCCCTTCCTCTTAAACTAAGCTTGAGTTACAAGGGC
TGGGTGGCAAGTTGCCCTTCAGAGCATTGTGGATAATACGTTTTAGAATTGAGAGCTTTC
AGAAGGGGAAGCATGAGAAATCAGATCTAGATCAAACTAACCTTAGTCCTTACGTGGAGA
GGCAGAAAGCTGACTTTTAATGGTGTTTTGTAAACCTGTGTAATCCCGCTTAGGAGCAGA
GGCTTACTTGCCCGGAGCTTTGTGCTAGATGAGGGGTAAGAATTTAAGAGATCAGAACCA
AATACTGGGCAGTGAATGTTAAGCTACATGGCAGAGATAACTTTGAATCTCAATCTTTTG
TATGAGCCACTGCCCTGTAGGTTTCTATTTCCTCTTCCTAAGATGATTGAGAGCGCCAGG
GGGATGGAGCTAATCTGCCACCTGATTCATTTGGGTCCCAACAGCGAATTGTGATAACCT
AGGGGAGCAGGCTGTTAAGTGTCATTATGTAGGTGACAGATAGTGGATTAGCTGATCTTT
GCCAAAAAGCTAATTCGTGAAGGAGCTGCAGTTTTTCCCTTTGGTACTGAAGGTCTACTA
ATGTCTGGGTATTTCAGTGGGAATTTATAGCACGATTTCATACACTTCTCGTTCCAAATT
TTCTGTTAGAAAAAATGACAACTAGCACACATTTTTACTTTTGTTGAAGGGTTTTTATTC
TTGTTGCACAGGCTGGAGTGCAGATGGCACGATCTCATTGTATCTTATTAAGAGTGTAAT
GGTGCAACCCCTGTCCCCTAGTTCAAGGGATCCTCCTGCCTCAGCCTCCCGAGTAGCCAG
GATTATAGCCATGTGCCACCACGCCTGGCTAATTTGCATTTTTTAGTAGAGATGGGCTTT
CTCCATGTTCAGGCTGATCTCCCTACCTCAGGTGATCCGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1799..2008, 2318..2523, 2836..2988, 3076..3631, 3857..4059, 4289..4487, 4647..4879, 5215..5640
1804..2008, 2318..2523, 2836..2988, 3076..3631, 3857..4059, 4289..4487, 4647..4879, 5215..5397
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved