Macaca_mulatta Locus RPS3
snOPY snoRNA Orthological Gene Database
Macaca_mulatta RPS3
Macaca_mulatta
RPS3
14
SNORD15, SNORD15
1924..2071, 5923..6068
8495
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGCCGGGCGCGGTCGCTCAAGCCTGTAATCCCAGCACTTTG
GGAGGCCGAGACAAGCGGATCACGAGGTCGAGAAATCGAGACCATCCTGGCTAACACGGT
GAAACCCTGTCTCTATTAAAAAATACAAAAAACTAGCCGGGCGAGGTGGCGGGCGCCTGT
AGTCCCAGCTACTCCGAAGGCTGAGGCAGGAGAATGGCGTAAACCCGGGAGGCGGAGCTT
GCAGTGAGCTGAGATCCGGCCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCT
CAAAAAAAAAAAAAAAAAGAGAATTGAACTCTAAGATCCTCTGAAGTCTAGCAGTCCTGC
TGGTCGAACCCCCTTTACTGTTCCTGCCTACACTCTTCCTTCCCTTGACGCCTTCTTTAC
GTAAAAACTACATTTCCCATGAGCACCCATAGGCGTCCACGTAGCGCAGCCCTCCGCCGT
CGCTCGCGCCCTTTATACTCACTTCCGCCCGCCCGCCACTTCTTTTTCTTTCGGCGGAGC
GCGGCGGCAAGATGGCCGTGCAAATTTCCAAGAAGAGGAAGGTGAGCCTCTGGGGACTGG
GTTCGGGGAACGACTGCGCCGCGAGGGTCAGGGGCTTCTCGGGTGCCACCGCGAGGCCTG
CAGCTCCGTGCCCTGCCCTGGGAAGCGGCTTAGGCTTCCTGGCATTCCCACGGGCCGCGG
ATGGCGGTGGATTGAGTGAGAGGCCCGAGCCAGGCGGGCGCTGTGTGGCCGGGTAAGGGA
GAGACAGGTTTTTCTCTGGTTCCGAGTGAAGCGCAGAGAGATGGGGACCAGGCGCCCCTT
CTGTCCCGGAGAAGGCGTTTGTGAGCATTTTTTGGTCAATGGAATTAGTAAACGTGGTAT
TTTGAGGGCGTGTGTCATTTCCCTCATGTCTTATCCCATGGTTTTGGGAAGGGGAGGCAG
CAGTGTATACTTGTCTTCTTACTGGTCGAGTCTGGGTACAGTCTGCTGGTCCCACGACCT
CAACATGAAGGGTTACTGACGATTGCTTGCTCCGTCTGAGGACCCCGGGAGGAAGCTGCC
TCGGATTTAACGCTTTGTTATTCCATGGGAAAGAACTGTGTAAAAATCATTAGCTTTAAA
AATAGACAGTTTGTCATTTCGTATACCTACACTTCGATGTTAAAATTAAATCCACAACTC
TTGTGAGTTAGGATTTTCCAGCTCTGTTTACAGTTAAAACCACAGGTACCGTAAGGCCAG
ATAACATGGCTGGGATTCTTTAGACGGTCCAGGTTGTGTCTGCAAGTGAGAGAGCTTATG
TTAAGTCCACTATCTATTCTGTTCCTTCACAGTGACAAGTACAGTGTCTTTGCTGTGCTG
AGTGAAGTGTAAATAGGCTATTTTAGAGCAGTTTCTTGTTTTGCATGTGGAACTGTTTTA
AACCCTTCGATGAAGAGATGATGACGAGTCTGACTTGGGGGTGTTGCCTTCGCCCAGGTT
GCCTACTCTGTGCTGCATTCTGTGGCACAGTTTAAAGGGCCCTGGTTGAAGTAACTTCCT
AAAGATGACCTAGAGGCATTTGTCTGAGAAGGGTTGCTGCACTCCTGTTGGAACAAGGGT
TTGGAACCATTGGTTGGAGGTATTTAGTTTTGGGGAGGGATGCATTGACTAATAAGACAC
TGGCTCAGGCGAAAGTGAGCCTACACCGATGTCCTAATTTTGAACTTCGCTTTTTTTGGA
TTAGTTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAATGAGTTTCTTACTCGGGAGCT
GGCTGAAGATGGCTACTCTGGAGTTGAGGTGCGAGTTACACCAACCAGGACAGAAATCAT
TATCTTAGCCACCAGGTAAAACTCACTTGACTGGCCATCACCTATAATTGTTGTAAATGC
TAAGTTGGTTTATTCCTTTTTTTGTATGTGTGAGACAGAGTCTTGCTCTGTCCCGAAGGC
TGGAGTGCAGTGGTGAGATCTCTGCTCACTGCAAGCTCCGCCTCCCAGCTTCCTGCCATT
CTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGGGCCAACCACCATGCCCGGCTAA
TTTTTTGTATTTTTAGTAGATTCGGGGTTTCACTGTGTTAGCCAGGATGGTCTCAATCTC
CTGACCTCGGGATCCGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCA
CCGCGCCTGGCTGGTTTGTCCTTTGTGAACTTAAGGGGATAGACAGCCAGTGAGTCTGGG
CTTAGTGAATGTAATTGCTTCTTAAAAGCTGGATTTTAAGGCCAGGCATAGGATCGCTTG
AGCTCAGGAGTTCAAGACCAGCCTGGGCAACATGCGGAAACCCCCTCTCTAAAAAAGATA
AGGTTGTGGTGGTGCACACCTGTGGTCCCAGCTATTCCAGAGGCTGAAGCAGGCGATGGC
TTGAGCCCAAGAGGTCCAGGCTGCAGTGAGCCATTGGTGTGATCCAGCCTGGGTGACAGA
GAGAGACCCTGTCTCAAAAAAAGCTGCATTTTGAAAATTTAACTTTAGTTTTTGTCAATG
AAAATTATATGCTTTGTGGCAGAGATTTTGCTACCACATATATATGCAAGATTTAAAGTT
AAATCTAGCATTTGTGAGAGTCATGAATTGTCACTTTTTCCCCGCCCAGAACACAGAATG
TTCTTGGTGAGAAGGGCCGGCGGATTCGGGAACTGACTGCTGTAGTTCAGAAGAGGTTTG
GCTTTCCAGAGGGCAGTGTAGAGGTGAGTGATTCTGGCGTATGCCAGAGATAATGGCTCT
TCAGAATGATAACTTCTAAAAACTGGGAGACTTTGTTCATTACAAATGGACTGATACAAC
TTTGTTGAAATTCTCTTAATGAATAATGGGCTTAACTTTGTAAGCCTGTTCTGCTAATGG
TTGATAGTTAAAGGATTTTACATTCAACTTGGGTATAGAAATGATGCATATGATGGATTG
ACTGTCCCCATTGGTGTAGTTGGTATGGCCAAAGGAGCCAGGGTGGGAGGGCAAGGAACC
TGCACTGTGTGTAGGTGGTAGAAGTGCTTTAGGAATTGAGGGATACTGAAATTATATGCT
GTTTGTGATGGTGTTGTGCAGTCTTTTGGCCTCCGTAGGCCACGTTGGAAGAATTATCTT
GGGCCACACTACTGGTAGTGCAAAAAATCACGATGTTCAATTTTTGTTGGGCCACAATCA
AAGCCATCTCCTGGGCAGCATGCGACCTCTGGGTTGGGCAAGCTTGGTCTAGAAAGTGAT
GCTTGTGTGACATGCCAAATTTTCAACTTTCAGTTGAAAACAGTGGTGATGGTAACAGGA
TGTCCCTTCCTTCCTTTAAAGCTTTATGCTGAAAAGGTGGCCACTAGAGGTCTGTGTGCC
ATTGCCCAGGCAGAGTCTCTGCGTTACAAACTCCTAGGAGGGCTTGCTGTGCGGAGGTAA
GTGTCCTGAGACCTAATAATGGTCATGACCTTTTGTGTGTATCAAAATATATGTCTCCTG
TTTGTTGATTAGCAGATGAACTGTTATAAAGTGACAGGATCTGCTAGTCTCCCAGGATTA
TAGTAAGATACTAAACCATGCCCTCACTGAATTGGCAGACTAGCAAGACTATGAAAGCAG
CGAGAACCATAAAGGGTGGTCAGTACTGTAATGGAGAAGTGTTCTGGGTGCTTTGGGAGT
TCAACACAAATAGAACTGTCCAAGGAGGGGACCAACTCCTGTTGGTCTTCTCGAGGAGGC
TTTACAAAGAGCCCTGTCGGGGAGTGCGGTGGGCAATGAAGAATAATTAGGCCTGTTACT
GGGTGTGTGTTATGTATCCCTAGATAGAAGTGCCTTAGTACTTGTGGGATACCATGAAAC
TTCAGTAGGAATCATTTGGATCTACTTAATGTGTTCACTCCTAAAATGGTACTATGAAGA
GATAAGATAGACCTGATGTGAGAGAGCTTAAAATCTAGACACTTAACCTCTGAGTTGCAT
GCAGATAGTAATGTGAGGGTGTACTGGTAAGATTTCAACAGGAAGTTCTTTGTGCAGTTT
GACTGTATGTAAAGGCATTGAAATGCCTTGCCTAGAGGAATGATAGGAAAACTGCTGTAG
GAAGGTTGACTGGTAGGGATGGGTAGTGTAGACAAGGCCGTAGGTAAGGACCTAGAAAAG
ACTGCTTACCTGGTTCGAGTGCCCGCTAGGCGCTTAGAACAATGGTTCTCAGAAGATTAG
TGCCAGTCCTAGACCCACCAAATAGGAAACTGGATGTGTGACTCAGCAGTCTGTCTTAGT
AACCCCTCCACATGCTAGTTGCACACATTGAAGCAAGTTAATGTACTTCTGAGCCTGGGA
TCTACTGTCTTCTAAGGTGGACCATCATACCACCTCTTAGTTGTGGAATATTAAGTAAGA
TAATGTGAAAGGGCCTGGAGGTGGCTAGCTCTCCAGTTAGTATCTCGCAGAGTGTAAACT
ACTGAATGAGTTGGGGGGTAGGGCATATTTTAAAATGTTTTATCAGCATTCTAATAGCAA
GGTAGCCAGGATCCTAGGTGGGTTAGCTTTCCTAGTGAATGAGACTTCGGAGGTTGCAGA
GTATTACAAGGGACCACAAAGTGGGTAATTGGAGTTTAAAAATGTGGTTCTCAATTTTGA
TTATACGTGAGAATCACCCAGGGAGCATTTTTAAATACATGTGCCTGTACTTTGCCCATT
TAATTGGCCTAGAGTAGGGCCTAGACATCAGGGTTTCTTTTGTTTTTTATTTTAGCCTTC
CGAGGTGATTCCAGTATGCAGCCAGAGTTGGAAAGTACATGTTTAGGAGCTTGACATACT
TGATGAATATTACCCTAAGATTCCGTGTGATAGGTGTGGAAGAGAATTGGTATCATTGGG
GCCAGATTCTGGTCAAATTTATTCTCCATTAAAGGAACATTGAATACTAAGTTTTTGTTT
TGTTTTTTAAACTTGGTGGAGGTCCTTGATAATAACACAAGTAGATCTCTTCTTTTCTTC
TAAAGGGCCTGCTATGGTGTGCTGCGGTTCATCATGGAGAGCGGGGCCAAAGGCTGCGAG
GTCGTGGTGTCTGGGAAACTCCGAGGACAGAGGGCTAAATCCATGAAGTTTGTGGATGGC
CTGATGATCCACAGCGGAGACCCTGTTAACTACTACGTTGACACTGCTGTGCGCCATGTG
TTGCTCAGACAGGGTGAGCAGCTGAGAGTGCTTGTCAAAGGGCATTTGTGGATAGATTTG
GTTTTCCACAGACATCTAAAAATTTGGGGGAGTTTATCATGGAAGCAGCTGGGTATGTTC
ATATTCCTTGGTATATCGATTACCACATTGATCTGTAAGAATCAAATTGCTGAGACCTGT
CAGATCCAAGAGTTGGTTTGTCTTTTTTAGCCATCTGTGTACCCTTCAGTGATGACATGA
TGACGAGTCAGAAAGGTCACCTCCTGCTCTTGGTCCTTGTCAGTACCATGTTCTGTGGTG
CTGTGCGTGAGTTCCTTCTGCAGAAGTGTCCTATTCATTGATTGATTTAGAGGCATTTGT
CTGAGAAGGGACCAGACCCAGGAGTGCTTGAGTAAACTGCTTGCTCTCTTTGGTGTTGTG
TGATGGGGGCCGGTGAGATCCCAGCTGTGTGCTAACAACTGTGGTGTCCTCTAGGTGTGC
TGGGCATCAAGGTGAAGATCATGCTGCCCTGGGACCCAACTGGTAAGATTGGCCCTAAGA
AGCCCCTGCCTGACCATGTGAGCATCGTGGAACCCAAAGATGAAATACTGCCTACCACTC
CCATCTCAGAACAGAAGGGTGGGAAGCCAGAGCCGCCTGCCATGCCCCAGCCAGTCCCCA
CAGCATAACAGGTATGTCTGCAGGGGCAGGGGCCTCTTGGGGCAGAATAGGGTCCTTCCT
AGTCTTTCTGTTAATACTTGTATCCCACATTCTGGTAAGCATTTGGTGAATAAAAATTGC
ATTTATTTACTTTATGTGGGAGAATACAAGTTGAAACCTGGGGTCTATTTAACCCTCAGT
TCCATTGGGACAGGTGTTTGCCTTTATTTTCAGAAGTTCCTGCTTTCACTCGTGTGTATG
AAATGAAATAGTTTTCCCTTATCTTCCCTTATTTGCTCAAGATTTTTTTTTTTTTTTTTT
TGAGACATAGTCTTGTTCTGTCACCCAGGCTAAAGTGCAGTGGCACGATATTGGCTCACT
GCAACCTCTGCCTCCCGGGTTCAAGCAATTCTCCTGTCTCAGCCTCCCGAGTAGCTGGAA
TTACAGGCATCTGCCACCAAGCCCAGCTAATTTTTGTATTTTTAGTAGAGACAAGGTTTC
ACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGGTGAACCACTGTGCTCAGCAG
CTATGGTCAACACCTGGGGTTTTTTTGTTTATAGGTGTTGTGTTTCTAGGTGCCTTGTAT
TTTTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTGTGTGGCAGGGGCTGGAGTGCAGTGG
CTGGATCTCAGCTCACTGCAAGCTCCGCCTCCCGGGTTTACGCCATTCTCCTGCCTCAGC
CTCCCGAGCAGCTGGGACTACAGGTGCCCGCCACCTCGCCCGGCTAATTTTTTGTATTTT
TTAGTAGAGACGGGGTTTCACTGTGTTAGCCAGGATGGTCTCGATCTCCTCACCTCGTGA
TCCGCCCCTCTCGGCCTCCCAAAGTGCTGGGATTACAGGCTTGAGCCACCACGCCCGGCC
GCCTTGTATTTTTTTTTTATATATAAAAAAGGACAAACCCTTATGTATTTTGTTAATGTT
GCTGCAAACCCTCAATGGGAGTGTGTATCCATTTGGTAAATAAGGAACTTAATAACTCTG
GTAAAATTTCTTACTTTTGTGCTTTATTTGGTTTCAGGGTCTCCTTGGCAGCTGTATTCT
GGAGTCTGGATGTTGCTCTGTAAAGATCTTTAATAAAATCTGGTACAAAGACACAAGGCC
TGAATAGACTGTTTAGTATTCAGACTGAGGGGCACGTTGGCCTCTGGAGCATTACATATC
TTCTTGGTACTATACTTGAAGTATTTGCAAGGGCCAGAACTGTAAGACCCAAGCAGAGCT
AACCAGAGAGAGATCTTTGTGTGATAGTGAAGACTGATAGCAAGCAAGGCAGCACCTTGA
TTCGTTGTCCTGTAGTTCAGGGTTATAGGTTTAGAAGAGGGCTGTATTTGAGTTTTTCCT
ATGCATAAGGCGATCCACGTTGCATATAGAAAGTGAACATAAATGGTCATTATATTTTGT
GTCATGCTGTGCTCTAAGTATTCTTTACACATGTACTCGTTAATCAACCTCTCTAAAGTG
TAAAGGAAATTTGCTTGTGCCACTGAACTTAAGATTCAGAAGTAAATTTGCCTAAGCAGT
ATAAAGCTATCATTAGAATCCACATTCCTAAGTTGTGTTCTCTTAGGGGATCATGGAACC
AGTCATTGGTACTACAGGCCATTATGTTCTAGAGACCTGTAAAGAACATTTAAATTGTCT
CTGATTTTATCTGTCAGTATTTTGAAGTATTTTCTGCCAGTATCTGTATTTTACAAGAAA
TTGGGCACTATTTTCTCAGGCAAAACTAGTGAGGGACAGGTTGGCTTGAAAATCATACAA
GACTGATGATAAATCACAGTCTGGTTGATCACAGAGGGGAATTCCAGGGACAGCTATTAT
AGTCCTGGAAGGCCAAATCCGGTGGCTGCTTCCTGGTGATGCAGCCTGACGGGTGAGATA
ACCCTGGCTCCATAGACCGCTTAGCAGATGCTGTGATTATTTGGTTGTCTTCTCAATTAG
ACTGAGCTGCACATGGTAAGGGCTTAATATTTGAGGTAATTATGTAGGGCACACACTCAC
AAGTTATCTGCCCCCTTCCCTTTCTGACTCATAAATGGGTCATCTTAACAATTTAAGTGT
ACACTTCTATAGTGATAGCCCTCTGTCCAAGGGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1060, 2224..2354, 3169..3262, 3861..3955, 5525..5712, 6174..6370, 7417..7495
1031..1060, 2224..2354, 3169..3262, 3861..3955, 5525..5712, 6174..6364
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved