Macaca_mulatta Locus ENSMMUG00000021828
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000021828
Macaca_mulatta
ENSMMUG00000021828
14
SNORA3, SNORA3
2400..2529, 3602..3732
5010
AATAAATTACATAAGGGCTGTACTAGATTGTACGGTGGTACAGGTGGGGAAGCGAGGAA
CTATGTCTGCATTGTGTCCAGGAAAGGGTCACAGGCGTGTTATGTAGATTCTGGAGAAAA
TTCAAAAACAGCATTTATTTTTACTTATTTACTTTTGTATGTAGAGACAAGGGTCTCACT
ATGTTGCCCAGGCTGTTGTTGAACTACTCGCCTCAAGCAATCCTCGCGCCGCGACCTCCG
AAAGTGTTGGGACTACAGGTGTAAGCCACCGCGCCTGGCCTAAATGTGGCATTTAGAAAA
AGTATTTACAATATCTGCATTAAAAGAACCATAAAGCAACCAGGCATCTAAGTCCCTGAA
CCGATTTAAGTTGCTCAAACCTGAGAGGACAACCAAATGATAGCAGAAGGGCAAAAGAGA
AAGGAAGCCGGAGTGCCCACTCAGGAGTGTGAGCGGGAGGAGGCATTTCGGGAGCCGCCC
GAGCTTCAGAAAACGGAGCGAGACACCAGTTGGCCATACTGAGGATTAAACAGGGCCTCG
CGGTTCCGCACTGCGGCCGGGAGACAAACCAGCCGCCACTCTCACCAGCCCCGAGCAAAC
CACTAAGAACTGGGGAGGCGCGCGGGGCGGCTCAGGGCTGGCGCATTTGGTGAGGAGCTT
GATACCGAGGCCCTTAGGGTCGGCTTAGGCGGTTCCCTGGTCCAGGCGCCAGAAAAGGGG
CCGGCTCAAGCAGGCATGGGCGGCGTGCAGTACAGCACACCTAGCCCCGATTCTTCAACA
GTTCTCGTCTTCCGAGCCTGTCACAGCCGGCTTCACCGAGACCGTTCACCCCCACCACAA
GATTTTGTGAAGGGTATCACCACTCCGAAGAGGCGACTAGGAGACGCGCAATCCCGCGAG
ACCAAGAGGCCCCGCCCGAAGCCCGGCCTCTGTGACCGGAAGTGAGGCACTTGGCCCCGC
CCCCCGTGCCCGATACCTCGCGAGACTTGGCGAAGGCCTTCCTTTTTCGTCTGGGCTGCC
GACATGGTAGGTGTTTCGCTTCTTGCCTCCTCTTCCTTGCCGGCGGGGACTCCTAAGCTC
ATTCCCATTGCCCCTAGTCATCCACTCTCTACCATGGTCGGGGCTTCCAGGCTGCGCATG
GCCGCCTGCAGGGCAGGGTGGCCGGCGCGGGCGCGGGCGCGGGGCGGTGCTCCCGGAGCC
GTCTGTTAGGCCCGCGGTTCAGATCTCTAGGACACGCGGCCTCCGGCGCTACCGTGGTGA
GCACGGCCCTAGGCCGATCGGTACCCTCAGCTTTACCGAACGCTCAATTAGTTGGGTCCT
TGATCCACAGGCTTACAGGCCCATCTCACAGCTGGCAGGCATCGCCCCCTGCCCCTAATT
CCTTAGGCCTTACCACCAAGCTTTTTCCACACAGCCATCCAGACTGAGGAAGACCCGGAA
ACTTCGGGGCCACGTGAGCCACGGCCACGGCCGCATAGGTGAGTGCCGGCTTCCCTTCGG
GGTGGGCCTTGGGCTCTCTTCGGGTGCTTAGCTAGTCTGGAGATCGGTAGCCTATAAGAA
TAAGACCTTTTTGTGGGGTCAAGTTGGACAGCTGTTGATTTTTTTCTGAGGATCCTGTAG
TAGTCCAGTTCTAAGGAATTTCACATCAGTGGAGTAATAGGAATTCAGCAGGCACGGTGT
TAGGTTAGTTGAAGACGTGGAGTACTGTGGGAATGCTGTGATGTGGAACCTGAAAAGATG
TTTCACCCGGAATCCTGAAGTAATCGCATTGCTGAAACCGGCATCGGTAGGGTAGGAACA
GCGTAAGCGGGACACAGACGTCTGGGGAAACGCTCGGCTTTTGTACGAGGAAGTATTGAA
TGGCATGAGAAGGCTGTGTGGTGCATGTAGCTTTTTTGGGGGGGGCGAAGGGGAAAGACT
GATCACTGTCGCCCAGGCTGGAGTGCAGTGGCGAAATCTCGGCTCAAGCGATTCTCCTGC
CTCAGTAGCTGGTATTACAGGTGTGCGCCACCACGTCCGGCTAGTTTTTCTATTTTTAAT
AGAGTCGGGGGTTTCTCTGTGTTGGCCAGGCTGGTCTCGAACTCCTAACCTCAGGTGATC
CGCCCGCCTCGGCCTCCTAAAGTGCTGGGATTACAGGCATGAGCCATCACACCGGCCCCA
TGTAGCTTTGTATTCCTGCAGGCAAGCACCGGAAGCACCCCGGAGGCCGCGGTAATGCTG
GTGGTCTGCATCACCACCGGATCAACTTCGACAAATAGTAAGTGTCCTTGGACTGCTTTT
GACACAGCTTGGGAGGTAGGGGCAGAGAGAGGGCTGGCTTAAACAAAAAGTTTAGAAGCA
AGCCTTGCCTACTGCTGTTTTTTTACCAAGTTAACACTTCGTGTGAACTGAGAACCTGTC
ATCGAGGCTAGAGTCACGCTTGGGTATCGGCTATTGCCTGAGTGTGCTAGAGTCCTCGGA
GAGTAACTGCTGATCTTATTCACTGGCTGTGGGCCTTATGGCACAGTCAGTCACCAGGTT
AGAGACATGCTTCACATTCACCTACTCACAAACTAGTGGATGATAAATTTTGGCTATTCG
GAAGACCTTTATTATAGGAGTATGTCGATTTTCCATAGAGTGCTGTTATGTGGCTTGAAT
TTTAGTCTCAGCCCTGCCTCTAACATTGTGAGTGGTTTATCCTGGTTCCAGGAAATAAGA
CTAGCCTTTTCCTCATGATAGTCTTTGGTTGTTTTTAAAACCGTTGTTTAAGTCAACAGA
TGTATCATGTGCCTGACACTGCTCTACATCAGTGAACAATTTACACTGTAATGGGGGAGG
TAACTATAAAGATGATAAACATAGCATCTTAATTGGAGTGTGTATGAAAGTGGTTGTTAT
CTCTTCCTAGCCACCCAGGCTACTTTGGGAAAGTTGGTATGAGGCATTACCACTTAAAGA
GGAACCAGAGCTTCTGTCCAACTGTCAACCTTGACAAATTGTGGACTTTGGTCAGTGAGC
AGACACGGGTGAATGCTGCTAAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGC
GATCGGTAAGTTAATTGGATGTTTTTCTATACTTCCATACCTTCCCTTACAAAAACTCTG
GCTTAATCTTAAAACCTGTACTTCCCAGTTACCTACCAGACATCGATTCTTCCTGTGGTA
GAATTATCATAGGTATTTCCCTGTCAGTAACAGTGCCTACTGTCACTGCCCAGGTTGTAT
CAGGTTTGCATTTCGTGCTTGAACTATAGCTGGTTCTGATCGAGCACAGCTCTTGGCCCT
TCATGTTCCCCAGATAATAGAATCCTAATACGTTCCATCGATATTCAGTGCTGTACATTA
TCTGAAGAGATTTTCCCCCAAAACAGATATATTTTGTCTGTCCTTGGTGGGGGGTTCTGG
TCCCTGTGTTAGTCTTAACTCTCATGAATATGGAGATAATCTTAAGAGGCCAGAACCCTA
GGGGCGCTTTAAATTGACTTCCCAGCCTATTTAATGTCCATTGAGTAGTTTTAGTGGTCA
GGAAGGTGGTTGTCTTCTTTTGCTTAGCAGGGGGTTTTTGAGCAGGAGGAGGCTTATGCT
TTGCCGAGACTAGAGTCACATCCTGACACAACTCTTGTCCTGGTGTGCTAGAGTACTCGA
AGAGAATCTTCTGGTCTTGATTCACTGGTGGGGGCAGTTGGTGCCCCCATTAGTGCCCAG
ATCAGAAACATACATACCCTGCCTAGGGATTTAGAAAGTGGGCTGGCAGTCTTTCCTCAT
ACCCATCACGCAGTAGGTACCTGCTACAGTGTATTGTAAACTTTTTTCTCTGTTCTTCCA
GGGCTACTACAAAGTTCTGGGAAAGGGAAAGCTCCCAAAGCAGCCTGTCATCGTGAAGGC
CAAATTCTTCAGCAGAAGAGCTGAGGAGAAGATTAAGGGTGTTGGGGGGGCCTGTGTCCT
GGTGGCTTGAAGCCACGTGGAGGGAGATTCATTAAATGCTGACTACTTTTTCTTTGTGGT
GTGAGTATAGGTTCTTCAGTGGCATCTCTACATCCTGTGTGCATTGGGAGCCCAGGTTCT
AGTACTTAGGGTATGAAGACATGCGTTCCTCTGCTGACTTCCCTCAGAAAGTATATGGTA
AAGATAAGACCAACACAGGCATTGGCCAGTGAACCATTTCTGTTTATAAAGTCAGAATGA
TACCTGTTGATCACTGAAAGGTCTGCATGTATTGTATTCTGAATTTTACAGTGAATGGGA
GAATGTACCCTAATTGTTCGATGGGGCTCAAAAGGAAAGATTCCATTTTTAATGGTTCAC
ATTCTAAAGAAGGGCAGTGTGATAGGAATGAGGTGGTCCTTTAGGACTTAATTCCTCAGC
CCAAGGTTTTTCCTCTTGGCCCCCCTTTTTTTTAAACGGAGTCTCTCTTGCCAGGCTGGA
ATGCAGTGGCATGATCTCGGCTCCCAGGTTCAAGCAGTTTTCCTGTGTCAGCTTCCTGAC
TAACTGGGATTACAGGCACCTGCTACCATGCCCAACTAATTTTTGTATTTTCAGTAGAGC
TGGGGTTTCACCATGTTGGCCATGCTGGTTTCTTAACTCCTAACCTCAAGTGATCTGTCC
ACCTTGGCCTCCAAAAGTCCTGGGATTATAGGTGTGAGCCACCACACCCGGCCATGGCTC
CTTAATCTTCATCGAAATTCTTGTTATATTTTGAATGTGATGAATCAGAGTCTGGAGATG
GGGGTCCAGCAATCTGCAATTTCAATATGCCAGGGCTTTTCTGTATGTCAAAGTGGGTTT
GAGATGGTTAATTTTTCTTCTAGTCTGAAATGTATCGAGAAAATTTGGAAATCCTGAAGA
CCAGAAATTGAAATAAGTTTTTCTAGGATTTGTGTTTCTTGCTGTTGGAAAACTGATGGT
GACCAATGCATGTTTACAAATAAGATCCTCATAGATCTTAGGGTAAATTATAATTTGCTA
CAGTTTTATGATTCTTCTTGTGATTTTGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1414..1477, 2181..2256, 2890..3064, 3841..4010
1023..1025, 1414..1477, 2181..2256, 2890..3064, 3841..3966
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved