Macaca_mulatta Locus ENSMMUG00000022547
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000022547
Macaca_mulatta
ENSMMUG00000022547
14
SNORD14, SNORD14
2800..2889, 3804..3894
5153
CATCTCTACTAAAAATACAAAATTAGCTGGGCGTGGTGGCGCATGCCTGTGATCCCAGC
TACTCAGGAGGTTGAGACAGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTATGGCAAGC
CGAGATCGCGCCATTGCACTACAGCCTGGGAGTCAAGAGCGAAACTCCGTCTCAAAAAAA
AAAAAAAAAAAAAGCTATTTCCTTGACGGTTCCTTTTTCCCAGGAAATTCAAATGCCTCA
TTTTATCCCTCATCCTCTTGGCCTTTGCAATCTTGCTCCCAAGGCTCTTCCCTGCCCACC
AACTGTCTCACTTGGGAACACGGCTCCGTAAGCCTCTGCCCAACCCTTCTCCCCAGACAG
TCCAGCGCCCCAAAGCCCTGCGCAGGGGAATTCGAGTGCGGAGGGCGGCAGGCATCCGCG
GGGACCTGGTTCAACTCCTTAGACCGTTTCTTCACCGTCAGTGACTCTCCCGTGACAGAT
AAGAGTAGGATTTAGAAATGAGAAATGGAAGCGCCGGCTGGGGGGTAGCTGCAGCCATGG
CTTCCCGTGTGGTCATCACATGCTATTGTATCTGTTATTTCATTAGGCGCAGGGCCGACT
CTGAGGTATCTAGTTCCAGGGCAAAGCCAGGCACTGGTGAATGAGCAAACACCTGTGTAT
GGCTGATTCTTCTAGCCCTACCTGCTCCATGCCCACCCACAGCGCAGCATTCGAATCTTT
ATGATCTCGGAGTCCGAAGTAGGGAATTTCAACGCAAGCTGCTGTCAGCCTCAAATTCCC
GCTCTGGCCACAAGGCTGATCAAAGACCGATGCATGCCGGGATGAGGCCCGGCCGACTGA
CGAATCGCTTGCGACGCTGAAATGCATTTCGGGAGATGTAGTCACACAGACGACGGTGAC
TGCGCAGCGTAGCTCCGCCTCCTGCGTGCGAGGAAGCGTGGACGTGTGAGGTCACTTCCT
GCGTGTTGGGTGGCTTTCTACGGCGTTTGCATCCTCGCTCTCCTTTCGCTGCCTGACTGC
CGCCATCATGGGTCGCATGCATGCTCCCGGGTGAGCTCGGGGCATCGAACCGGATTGCTG
GGCGGGTGTGGGAGGAAGAGAGGGAGTGTGGGCAGCGGGCCGAGGGGATGATGTTCTGGG
CTGCTCAGGCACGAGCCGACACCTCACTTAGAGACTGCTTCTCTCCCCAGGAAGGGCCTG
TCCCAGTCGGCTTTGCCCTATCGACGCAGCGTCCCCACTGTAAGTAGCGCGCTGGGACCG
GGGAGAATCCGAGGAGGGGGGTGGCATTTGTCTCGGGTGAAGCGACGCCGGGGTGAGGAA
CTTGCGTGTATGAGGAGCGCGGTTTTGCGGGTGGAGAGGGCGCTGTGCTTAGGCGGCATT
CCTGGGTTCTCATCTTAAGGTTGCTTTCTATTCCATAACAGTGGTTGAAGTTGACATCTG
ACGACGTGAAGGAGCAGATTTACAAACTGGCCAAGAAGGGCCTGACTCCTTCACAAATCG
GTGAGTGTTTGTGTAGCCTCTTTCGCCTGTCCTCGTGTGACTTGTAGGATCTAGTAGGTG
GTAACGTTATTTTAAAAATCGCAAATACTATGGTCTCGGCACCGTGCTACAGGCATCATT
GTAAGCACTTTACGTGTACTGATCTCGTTTAATTCTGACCACAGTACTTTGAAATAAATC
TTCGTGGCTTTCCCCCCAGTTTACAGTTGAGGATCCAGAGGCACAGTGCAGCTGGATACT
AACCAGCCCCAAATCACACAGCTCTCAAGTGGAGGAGTTGGAATTGGCTAAGCAGAGTGC
CTGATACAGTTCTTCACAGTTAGGTGTGGTTTGAATCTCAGTTGCATGTGACTTCGTGCA
AGTGGCTTCATTCAGCAAATGTTTGCCTTCTGTGTGCTGAACATGGTTCTGGGGCCTGAG
AATATACTAGCCTCCTACTCCCCCGCCCAAAAAAGCCAGCGGCAATGTGCCTGTATTTCC
AGATACAGGTGCAAAGGTGGGAGGATCACTTGAGCCCAGAAGTCCTAGGCTGCAGTGAGC
TATGATGAAGCCACTGCACTCCTGGGTGACAGAGAGGCGCCACCTTTTTTTTTTTCTTCT
TTTTTTTTTGAGACAGAGGCTTGCTCTTGTCGCCCATCCTGGAGTGCAGTGGCGCGATCT
CAGCTCACTGCAACCTCCACCTCCTGGATTCAAGCGATTCTCCTGCCTCAGCCTCCCGCA
TAGCTGGGATTACACGCACCCACCACCAGGCCTGGCGAATTTGTGTGTTTTTTTGTTTTT
GTTTGAGACGGATTCTCACTCTGTCGCCCAGGCTGGAGTGCAGTGGCACGATCTCGGCTC
ACTGCAACCTCTACCTCCTGGGTTCATGCAAGCAGTTCTCCTGCCTCTGCCTCCGGAGTA
GCTGGGACTACAGGCAGCACCACCCCGCCCGGCTAATTTTTGTATTTTTTAGTAGAGACG
GGGTTTCACCATATTGGCCAGGCTGGTCTCAGACTCCTGACCTCAGGTGATCCACCGCCT
CGGCCTCCCAAAATGCTGGGATTACAGGCGTGAGCCACAGCACCTGATCCCACCTCTTAA
AAGGGGGAAGGGGGATGCAAAATATCTGTACTCTTGGAGCTTGTAGTCTAATTGGAGGTA
TGACACACCAAAAGAAAATGTGCCATAGATTGTAAGTAATCAGAACTCATTAGAGGTTTA
AAAGAAATAACGTGTAAAGTTTTTAGAAGAATGACCAGAGTTCTCAATAAATGTTAGCTG
TGGAATCTCAATTCCTTTGGTCATCTGTATTCCAGCAAACCCACTGGGATGATAGTTTTC
CAGCATTCTTAGTTTCCACCAGAAAGGTTTTCCTTAGTCTTGGGTAAACCTTCCTTGGAT
GTCTGAGTGAGCTTTATGTGCATTCCCATGTTGGTTTCTGTGATGTATAAAAGTATACCT
CCAGCTTACAGATAGGAACTATGCCCTGATTTCTGAGCCTCGACATCATCCAGTTAGTGT
TTCGTGTTGAAAGTTAAAACATGATTCCCTTTTCAGGTGTGATCCTGAGAGATTCACATG
GTGTTGCACAAGTACGTTTTGTGACAGGCAATAAAATCTTAAGAATTCTTAAGTCTAAGG
GACTTGCTCCTGATCTTCCTGAAGATCTCTACCATTTAATTAAGAAAGCAGTTGCTGTTC
GAAAGCATCTTGAGAGGAACAGAAAGGTAAGCTAATAAACAAAATCTGGTGCTAAATAGG
ACTGCTCGTACATGCATCTGGTTTGAATTATTCAAGGTGGCTTAGTACACAAACTAGTGT
AGTGTTGCTTTGAAGTTCAAATTCTACCCAAAGAGATTTTCATTAGAGAAAGTGCGTAGT
AGCTCTACATTGTCTTATTAATGTTTGATAATGTTCGGTCATTTTGGGTGGTTTTCTTGA
ATTGCACCAAATTTTATTTTTAGGATAAGGATGCTAAATTCCGTCTGATTCTGATAGAGA
GCCGGATTCACCGTTTGGCTCGATATTATAAGACCAAGCGAGTCCTCCCTCCCAATTGGA
AATAGTAAGTGTCAACTCTTTTGTTGTTGTTGTTGTTATCAAGCATAGGAGTCAGCCAGT
AGTTAAAGTCCTAGTAGTGAATATGTTCGGCCTTGGGGGCTATTTGGTTAACTGCTCTTT
GAGCTCTGGCCTGGTAGTGGGAAAACAGCCACAGGCAGTACATAATCGAATGGGTGTGGC
TGCTTGTCTTTAATAAGATAGTAGGTAAGTTTTCCTTTCATACCTCTACTCCCAGGAGTT
TGAATTAATTTTCGCATGAATTGCTCACTATGATGATTGATTGCCAGACATTCGCAGTTT
CCACCAGAAAGGTTTTTCCTTTTGTTGGCCAGTTCTTCCTTGGATGTCTGAGTGAGCATC
TTCATTCATTGTGCTTCAACGCAATGCGTTGGTTCAGGTATTCAGTAGTTTGGTGCACTT
TATATAGTTTGTATTTATTAACTGTTTGAGAATAGCACCATTAGTGGGGAGATTATCTGT
TAACGAATATGGAGGGACCGGTATTAATCCTGATTTTCTTTCCCCGTTTTTCTTTTTCAG
TGAATCATCTACAGCCTCTGCCCTGGTCGCATAAATTTGTCTGTGTACTCAAGCAATAAA
ATGATTGTTTAACTAAAAGCATGTTTTATGTTTATTTTCCTAGAAGAAAAATGTATATAT
ATCAGTGGTTCATATGTGTTGATCTTGTTTGATGGGGAAGTGTTTTAGGTGACTGATGTT
AGGATTCCAGGGAGCAGTAAGATAGTGTACATCACATCCCTTCATTGGCCCCTTAAACCA
GTTGAGCAGCTTATAACCTCATAGGTGGTTGCCTTAAATATGGAGAACTGGAAGACACTA
GGAAATAATGCCTTTGTGTTTGTTTTGGTGTCATGGCAAAAATGTTTCTAAGTTTTTTTG
ATACATTTAATGTTAAAGACAGATAGATCTCTGGCAGATGTTAACCACTGGTAGCATCAG
AAATAGTAATATGGGCAAAAGTAATTGCGGTTTTTGCCATTACTTTGATGCAAAAACCAC
AATTACTTTTGCACTAACCTAATACATAAAAGTGTCACTGGAGGGAGGGGAATCTGATAT
GGAGAGACATTGGATCTTGCAGTGAGGGTTAAAGATGAAGAAGGAATCTAGGGGACAGTA
AACAGGCACAGTTTGTCTGGAGCGTTGGGGGTTTAGGAAGAATATTTGAAATGGGCTTGG
GTTCCTGGCCTTTGAAAATATTTGGGTGGGTTAAAGTAAGATTTACTTGTTTTGGTATTT
TGTTTTAATTTAATTCTTAACCTAATGGGGTACATGGGTATTGCTGCTTGAATGACTAAA
ATATCAGACAACCCTAGGGAGTGGGTCAAAGTTACAAGACTTTGAACCACTGTCAAAGTG
GTTAAGCTGTATGTCTGGCTGGTGTGTGTTTATAGAGCCACGATCCTTCAGAATTCAGAA
AAAGGGCTGCACGTGGTGGCTCATGCCTGTAATCTCAGCACTTTAGGAGGCCGAGGTGGG
TGGATCACCTGAGGTCAGGAGTTCAAGACTAGCCTGGCCAACATGGTGAAACCCTGTCAT
TACTAAAAATGCAGAAGTAAGCTGGGCATAGTGGCAGGCGCCTATAACCCAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 1190..1238, 1421..1499, 3036..3205, 3443..3543, 4080..4153
1027..1049, 1190..1238, 1421..1499, 3036..3205, 3443..3543, 4080..4110
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved