Macaca_mulatta Locus ENSMMUG00000020073
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000020073
Macaca_mulatta
ENSMMUG00000020073
8
SNORA72
3765..3896
5475
TCGCAGCTCCAAGCCCAACAGCAACACAACGCCGAGAAGCTTAAGGGCCCGCAAAGAGG
GAAAGCGAACACCCCCGCCGCCATTCTTTTTTTCCCTTCTTTGAGACAGAGTCTTACTCT
GTCGCCCAGGCCGAGTGCAGTGGCGCGATCACGGCCACTGCAGCCTCGACCTACAGAGCT
CAAGCGATCCTCCCACCTCAGCCTCCGGCTGAGCTAGGAGTAACTGGGACTACAGGAGCG
CGCCACCACGCCCGGCTAATTTATTTATTTATTTTTTGTAGAGACGGGGGTGGTCTCACT
ATGTTGCCCAGGCTGGCCTTGAGCTGGACGCAACAGATCCTCCCGCCTCGACCTCCTGAA
GTGCTGGGATTAAAGGTATGAGACGCCGCGTACTGCTCCCGCAGCCATTCTAGCTAGCGG
TACCAAGAGCAACCCGCAGCGGCCCTCCGCTTTTTGTTCCGCCCCTTCTGCTTGCGACCT
GTTTCCGCTTCCGGTCCTGCAATTCCGGCTCTGCCGTGAAGAGCTTTGCATTGTGGGAAC
TCCTTCCTTTCTCGCTCCCCGGCCATCTTAGTGGCTGCTTTTGGTGAGTGGGCTCCTGCT
GACCAAGGTTTAGGCAGCGCGGGGAGCTTTGCGGGTTGCCATTTGGAACTCCGGATCCTA
AACTTCCTGTCCTGTCCTCTGTCTCTTCTAGCTTGGGGGCCGTCCCGCACCTGAGGCAGG
AAGATGGTGGCCGCAAAGAAGACGGTGAGTGAGGCGGGCCAGGCCCGGAAGCCGATTCAC
GTGGAGAGATGTCTCGGCCGGGGCGGGCAGATGTGAGCCCACTGGGGTGACAGCATGTCT
GCTGGCATTTGGAGGGCCCCAGAGGGAATCCCAGTGGCCCTCTCAATGACTTGGGGTCCT
CGACTTCGGAAGTTAAGAGGCTTGGCTTCAAAAAGCTGGGTCCAGTTTTGAAGTGGTTGC
AGACGAGGCCCTTAGGTCCGTGTTTAATGTTTGCTTTGTAGAAAAAGTCGCTGGAGTCGA
TCAACTCTAGGCTCCAACTCGTTATGAAAAGTGGGAAGTACGTCCTGGGGTACAAGCAGA
CTCTGAAGATGATCAGACAAGGCAAAGCGAAATTGGTCATTCTCGCTAACAACTGCCCAG
CTTTGAGGTAATCGAAGAACCTGAACGAGCGTCGCCTACCGCGAATTCATCGTGAACGAA
TATACAGGAGAGTAAACTTGTAATCTGAGTACCATGAACTCGAACACTTGCAGGATAATT
GTGGTAGCGATTGTGGTGTTTGGCCCTTCGTTGCCGTCTCCCCCACCCACCCCCAAATCA
TGTGCTCCCCTTCTGTGAGCTTATTTCTGGGGGAGAAACGTGTGTGTGGCAGGAGGAGTG
AAAACAGGACATTGGGGTTTGATGGAAGCACAGACACATTATTTGTTTTTTCCATGTATT
TTGTGTCCTGCTTTTTTGGTTCTTTTAGCTTTGAGGTGTCTAATGATGCTTCATTGTGTG
AACCTGTTTTATTGTCAAAAAACTAGGTAAGAAAAGTTGAGGCTGGGCCATGGCGTTGCA
GGCTATCATAGAATCACCTAGTTTAGCCCACTAAATCAGTTCTGAGTCAAGGTTTATGCT
TGACTCACTGTTCTGAAATTGAACTTAGGGGGTGTTGTAAATAAGCTAAAGAAACTTGGA
CCTTGCAGAATATAAACCATGTGACCAAATTTTCTGTGGTAATGCATAAGCTGCTTACAG
CGTTTTATATAGGGTGTCTAGTTATTGTCAAAGCCTGGAGGGCCCTTTCTGTCTTGTCCC
ATGGGTTGGGCTTTTCCCTAACCATTCTTTGAAACTTTAAAGCCTGTCTTCTCTAGTAGT
GCTTCTGAAACATCACTGTGCAAAGGAGTCACATGGGTAATGTTAAAATGCAAGTTCTGA
TTTCATTGGATTTGGGATGGGGCCCGAGGTGCTTTTTTTTTTTTTGAGCCAGAGTTTCGC
TCTTGTCACCCAGACTGGAGTGCAGTGGCACAATCTAAGCTCACTGCAGCCTCCGCCTCC
CAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGCGATTACAGGCACCCGCC
ACCATGCCTGGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCGCCATGTTGGCCAGG
CTGGTCTCGAACTCGTTACCTTAGGTGATCCACCCACCTCAGCCTGTCAAACTGATGAGA
TTACAGGCGTGAGCTACCAGCTTGAGGTTCTTTTTAAACTAGTACATTGTAGCACTATTG
CTGGTGTGTGGATCTACATAATTGAGTGGCAAGATAGTATAGGACTCCTTTCCGATTCCT
AAAACCATTAGTGTCTACTAAATTGACGCTGAAATTTTGTATTTTTAGTAGAGACAGGGT
TTCACCATGTTGGCCAGGTTGATCTGGAATTCCTGACTTCAAAATGATCCGGCCTCCCAA
AGTGCTGGGATTACACGCATGAGGCCAGAAATTTTAACTTTAAAACGGTGTCACTCCCTG
TCTAGAATTCTGGGCAATGGGGGATAGTGATAGAAATGGCTTATTTTTTAAAGGTTTGGA
TTCTGGATCCTCCACTTACTATTCTGTGGCTCAGTTTCATTAGATTAAAAAAAAAAAAAA
GAATAGGGCTGCGTGCAGTGGCTTATGCCTGTAATTCCAGCACTTTGGGAGGCTGAGGCG
GGCGAATCCCTTGAGGTCAGGAGTTCGAGACCAGCCTAGCCAGCATGGTGAAACCCCATC
TCTACCAAAAATATAAAAAATTAGCTGGGTGTGGTGGTACATGCCTGTGATCCCAGCTAC
TTGAGAGGCTAAGGCAGGAGAATCACTTGAACCCGGGAGGTGGAAGCTGCAGTGAGCCAA
GATCGTGCCACTGCACAAATAATGCTTTGCTTTTGTTTATTTGCATCCTACTGTCTTCTG
TGAGTATTAATACTGTCTTAAACATGGTAGGGGTTGAGTAGATATTTGCTGGTTGCCCCT
TCACTTGCAAAGGATACATATAAATGTTGGTTTATATTGGATAATGAATATGATGTTTTT
AAGGGTAGTATGTGATTTTGTTACTTTTTGAAGGCCTTAAGAACATTAACACTAGTAAAA
GAAGTAGTAACATTTAGTCTGTCAGTCACTTGGTATTGCATTTATTTATTTGCCTTTTTT
TGGTTCCCAAAGGAAATCTGAAATAGAGTACTATGCAATGTTGGCTAAAACTGGTGTCCA
TCACTACAGTGGAAATAATATTGAACTGGGCACAGCATGCGGAAAATACTACAGAGTGTG
CACACTGGCTATCATTGATCCAGGTATGCTTTTTAAATCATAAAGTCTTTTTTTTTTTTT
TTTTTTTTTTTGCCTTTCTAATGTAATGTCTGGACAAGTATTTCTTACTACGCAAATGTC
TTTGGTTCCTAAATTCAGATAGAATATGGATATAGCAAGGCAAATCCTGTAGTTGTCTTT
TGTAGCAAATTGGTTATGAATGTCAACACATTATAATTGGCTTTATTATAAATTAAAATT
TTTACTGTCAGATAATAAATTTCATTTGATAAAGTACCTGTGCGATAATGACTTAGAGAT
TTGGTAAAAGGTGAAATTATAAGGGGAGAATAATCTGGCAAAACAGAAGAAAGTAATTCT
TGCTTCCAGAGAATAGACATGTAAAATTAGCTTGAGGAAAAAAAAAAGTGCCAAAAAATC
TACATCATTTTGTTTTCCAATTGTGAATCTTTGATTCATAGAATACTGCGAATATTCTCG
CTGTTCTGATTTTGTAATAGTCAGGACAGGCTAAACATTCGCTATATTAAGACCATGCGT
GTGTCCCCAGACCTAGTTCTTTCCCTAGGTCTGGTTTTATAAATGCTGGTGATAAACCAA
TTTTATTATATGATCGTTTTGTGTGATCATATAATGGCTATGATTCTGGGTTATCTTTGA
TTAACCTTAAGAAAAATGACAGTACAGGTAATGTGATAACTTTTGCAAAAAATCAATGCT
GGCCGGGCGCGGTGGCTCACGCTTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGCGGA
TCACGAGGTCAGGAGATCGAGACCACGGTGAAACCCCGTCTCTACTAAAAATACAAAAAA
TTAGCCGGGCGCAGTGACAGGCGCCTGTGGTCCCAGCTACTCGGGAGGCTGAGGCAGGAG
AATGGTGTGAACCCGGGAGGCGGAGTTTGCAGTGAGCCAAGGTCGAGATCGCGCCACTGC
ACTCCAGCCTGGGCTACAGAGCTAGACTCTGTCTCAAAAAAAAAAAAAAAAATCAGTGCT
AATTTGCAGACCATTGTCTACAGAAGGGATAACCAAAGGTAGAGAAATTTTATGGTACCA
GTTGCTATTAAATAAATTGTAAAATTACTGTATTTTTATTTTTTAGGTGACTCTGACATC
ATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAACCATGCAAAATTTTCCTTTAATA
AAATTTAATTGTTTTAAAAACATTGTATCTATTTCAGTATTTTTCTCTATTTTTGTTTCA
ATACAATTTCCTGAAGGTTGGATTAGAGAGGATGAGGCAGATGTGGTGGCAAGACTTTTC
AGTAGTTACACATCCTGATTTCTGTTTTCCAGGGTTTTTTTTTGTTGCTGTTGTTGCTGT
TTGTTTCTTTTTGGAGGCAGTGGTGCAATCTTGGCTCACTGCAGCCTCTGCTTCCCAGGT
TCAAGTGATTCTCCTGCTTCAGCCTCCTGAGTAGCGGGACTACAGGTGCACACCACGCCG
GGGTTGTTTTTTTTTTGTTTTTTTTTTTAGTAGAGACTGAGTTTCACCATGTTGGCCAGG
ATGGTCACGGTCTCCTGATCTCATGATCCCCCCATCTTGGCCTCCCAAAGTGCTGGGATT
ACAGGCATGAGCCACCGATCCCAGCCCAGTTTTTGTAAAGGGAGGGCACTGGGTTCCTTT
CTAGTACTAGAGTTTTAAGATGCTCAAGTTTTGTAATACCATTCTCAGGACGTTGTTTGC
ATTTTATATTTGAGTGTGTTTAGGAGGCAACAAGGTTAAATGCCCAGAATTTAGCCAGAA
TTGCAATTTACCAAATCTGAGTAGCTAAAAAAGATTAACTGAAATGTTTCTCCATCCAAA
ATGCTGTCATAGGTCAAGAAAAGTTTTACTTTAATGAATAATCTTTCCTAAGGTAAGTAG
TTGGTGCACTTGGACAATTTCTGAGTAATCCCAGATAATCAGTAGTTAAGTCCATGTTTG
CCCAAGTATGTTTTAAATCATATACTCCTAAAAGATACACTGTGAAGTACGTTAAGTATT
CACATTTTTGGAAACTATACTGCATCCCCCAAGAGTATGTCCCAGGGAATCCTTCATACG
TTAATATCCTTTGGAACATTCAAAGGAATTAATTTGAGGGGAAATAATGATTTAGTTAGA
TATTAATTTACAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1146, 3192..3322, 4426..4475
1001..1146, 3192..3322, 4426..4472
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved