Macaca_mulatta Locus ENSMMUG00000015102
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000015102
Macaca_mulatta
ENSMMUG00000015102
13
SNORA64
1703..1835
3068
TTACTACTATTGGCTCTGGTTTACTAGACTGCTGTTATTATTGTTGTTTTATTTTTACC
GTACTTGGAACTAATATGTAAATTAGAAGAGCAAATAGAAAAAATAACCATTTCATGGCA
GGCTATATTTTGCTGTTATTAGAATAACAGAAAGTAGATAACATTAAATCTTCATTAATC
AAAATTAATATACTGATTTTAGAGGCGACCTGAAAAAGAAAAAATAAAATAAAATTACAG
TGTGTTGTTAACCAGAGCCAATTCTAATCCTGTGGCAAGCAGATTTTAAGATCAATACGA
TGGTGTGCATCTCTACTCACAAACACCCAGGACGCTTAGGCAGGAGGATCGCTTGAGCCC
TGGAGTTTGAGTTTACAATGAACTATGATCATATTATTGCACTTTAGCCTGGGCAACAGA
GTGAGACTCCATCCCTAAAACACATTAAAACAATTTTAATTTAATTTAATTTAAAAATGA
TCACAGTCCTATGATCTCTGCTTTGTGCTGTTGACATCCTTATGAATTTCCTTCCCTTGA
ATGTGGGCAGTACCTGTGCTTTGCTTCTAACCAACAGAATGTGGTAAAGGTGATAGCCTT
TACTCATGATTATGTTACATTGTATAGTATTTACTCTTACTGGCAAACTTTCTCTATTCT
CTTTCTGTCCCCTTGCTAGCTTTGAAAAAGCAAACTGTCATGAAGTGTAAAATCACAGGG
AACCGAATGTTGCCAACAACTATGTGAGAGGGCAGTGGACCTTCCCCTGGGTGAGCCTCC
AGATGAGAACCCAGACCCAGACAACACCTGCATTGCAGCTTGTCATACCCTAAGCAGAGG
ACCCAGTTAAACTGCACCCAGACTTCTGATCTAAAAAACACTAAATTTTCTTGTTTCAAG
ACATTAAGTTTATATTAATTTGTTGTTTACACAATACAATTTCATAATCAAAAAGTAGAT
TTAAAATATAAATGCCGCCTTCTTTTCTGAGAAAACACCAAATGGCGGATGACGCCGGTG
CAGTCGGGGTGCCCGGAGGCCCTGGTGTTCCTGGGATGGGGAACCCCGGTGGCTTCTGCG
GAGGTTTCGGCAGTGGCATCCGGGGCCGGGGTTGCGGCCATGGACCGGGCTGGGCCGAGG
CCGCGGAGCTCGCGGAGGCAAGGCCGAGGATAAGGAGTGGATGCCCGTCACCAAGCTGGG
CCGCTTGGTCAAGGACATGAAGATCAAGTCCCTGGAGGAGATCTACCTCTTCTCCCTGCC
CATTAAGGAATCTGAGATCATTGACTTTTTCTTGGGGGCCTCTCTCAAAGACGAGGTTTG
GAAGATTATGCCGGTGCAGAAGCAGACCCCTGCTAGCCTGAGCACCAGGTTCAAGGTGTT
TGTTGCTATTGGGGACTGCAATGGCCACGTTGGCCTGGGTGTTAAGTGCTCCAAAGAGGT
GGCCACCGCCATCCGTGGGGCCATCATCCTGGCCAAACTCTCCATTGTCCCCGTTCGCAG
AGGCTACTGGGGGAACAAGATCGGCAAGGCCCACACCGTCCCTTGCAAAGTGACAGGCAG
CTGGGGCACTGGCATCGTTTCAGCGCCTGTGCCCAAGAAGCTGCTCATGATGGCTGGTAT
CGATGACTGCTACACCTCAGCCTGGGGCTGCACTGCCACCCTGGGCAACTTCGGTAGGTG
GTCCAGGAATGGGGCATAGCCATGGTCTCTCAGTTCCGCTTAACCACACGGGTCCGGTGT
GTGCTTGGCGTGTTTTCACGGAGGCAGAGAAAGGCTCTCCTAATACACGACAGACCCGCT
CAGAATGGCCTCTCTGTTCCTAGGAGTGCGACAATTTTGGGGTTGGGAGACTTGCCTCAA
GCACACCACTGACCCTCCTGGGGTTCTTTTTTTGTGCAGCCAAGGCCACCTTTGATGCCA
TCTCTAAGACCTACAGCTACCTGACCCCTGACCTCTGGAAGGAGACTGTATTTACCAAGT
CTCCCTATCAGGAATTCACTGACCACCTTGTCAAGACCCACACCAGGGTCTCCGTGCAGC
GGACCCAGGCTCCAGCTGTGGCTACAACATACGGTTTTTATACAAGAAAAATAAAGTGAA
TTCAGCCTGTTACTGTCTCTCTCTCTATATATATATATATATAATGCCCCATAAGAAAAA
GCATGTTAGTCTAAATTGCTTTCATGAGAGCCTTTCCTTTAATAGATATGATAGTGAAAT
GGAGACTGGAAATGATATAGAAAGTACTATGGAAATAGGAGAAACTTGCATTAATTACTC
AAGAGGAAGAATAATCATTTAAAAATTTAACAAACAGATGAAACTACTGTATTATTAGAA
TCAAACATCCAAATCATCCATCAACCCGGGATCTCTGCCAGAATTGCCGTCTTTGTAATA
TTGCAAAGTCACTGTTTCTCCAGCTGCTCTTACAGATCTAGAGTTCTCTTGGATGGTTCA
TTTGAACACCAAATTCTGGTCACTTTATCTCTATGGGCTTGTAACTCCTGACCTCTGCTT
TTCATATGGTTTCCTCTCACTGAGTCCTCATCACTCCTGATCTGTTTAATAGCATATCAA
CTAGTCTTCAAGCCTCATTTATTGAACAAAAACATGAAGTTTAGTGTTTGCGCAATGTGG
CAGATTGCGCAATAAAACATTGTATAAACTGTCTTCACAGTATCTTTGTAAGTGACAGAC
CTACCCAAATAAAAAAAAAAGATCTATCAAAGGCAAACCATTATCAAAGACATTATCTGA
TTTTGTATTTCAGTAAACATTCAATCAGTCCATCTATTAAAAATAGCCTGGATCAGTCAA
ATGTTTTACTTAGCTAAGAAAAATAAAATGAAATCTCTATTTTTATGAAAATGCAATATA
TTTTAACATATAAAAGTAATAAACCTTTAAACACTGTTTGCTTAATGCTAAAATACAGAT
ATTAATAGTATTTACCTGATAGGGTTATTGTGAGAATAAGTGAAAGAATATGCTTAAAGT
CCTGAGAATACCACATAGGACATAATAAATATTCAGTAAATTATAGTAATTTGTGTTATT
TGGATTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1132..1672, 1899..2068
1001..1129, 1132..1672, 1899..2068
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved