Macaca_mulatta Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Macaca_mulatta EIF4A2
Macaca_mulatta
EIF4A2
2
SNORA63, SNORA63, SNORA4
3779..3905, 4740..4871, 5048..5186
8341
TAATTGAAAACATCTGGAGCTTAAAGACTCGTGCAGTTTACGCAGCAAGGATATTATTG
CTCTGAATTTCAATAAATCAACATTTCACTATATATCGGTAAAGCTCAAAGCCCTTAAAA
AATGACCAATATAGACGGAATCAACACCGATGTAGTCCCAAAGCGGCACAGAGCTGTATC
TGCCAAAGCGTCCATTTAAATTCGTGCGTTCCACGGAAAATTACTGCTCCTTAGCTTCTA
TCCATTTGCAAAAGTTTATGATTTTTTTCAGGCATTCCTCACACCTGTTAGGTTAAAATC
ATTAACACTTTTAAAAAGAAAGCGAGAGACCGGAAACGATATGAGAATAGAATTGGCTAC
TCCAGAGACATCTGCAAATGACACTCCATTTTTTTTTTCTCGCTGCAAAATGTACCGGTA
AACCAAACTTTCCGGGACTCGCTGGGTGGCCGACATTTTCCCTAGCAGGAATTTTACGTT
TCCAAGATCTGAATGGATGTTAATGGTCGGGCTAAATGCCAGGCAGGTCTTCACTGTCAA
ATTAAACAGCGGTGGGAGCAAGTGGAATAACCGAGTTCCCCTCCCGCACCTGAGCGCCGG
CAGCGAGCCGCGAGTCGGGACCCCTCGCACGCGGGAAGACCCAGACGCCCAGCGGGCAGC
GTCTCCGGCTTCCGCCTCCGGCTCCGGCTCCGGCTCCACTCCCCCGGCCCGCCTCTGCGT
CAGGGACGCGGAAACCCCGTAGGAGCAGGGCGGGCGGGGAAAGTGGTGTTTGACTAACGC
CGCAGCGATATTCTTCCGCCGCGAGGTAAAGAATCCCAACCCAACCCCGGGCCCTAGGAT
TTCCAGCGACCCTATAATATCGAGAAATTACCACATTTGGATTTTCCAACCGTCTTGCTT
AGGATTTTATCCGACGTAACGACCCCAGGATCACAATTTTGTGGCTGACCGAAGCACGGC
GAGAAAATTCCTCCGCAAGAAACGGGTTCCGGCCACGAGCCTATAAAAAACGGGTGGCGG
GGCTCTGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCC
GCGGATTATAACAGGTATGGCGCTCTGTTGGCGGTCGCGGTCTGTAGTGAAGGTCGTAGG
GCGCCAGGAGAGATTATAGTGGATGGCATGGAGGCAAAAACTCCAACTTAGTGCACGTTT
CCTTAGGTTACAGCACCCCTGTGCCCTTCCAGAAGCTTCCATGATGGGTAGGGCCCGGAT
TGTGGGGAGACAGGACGATGGTGCGAAAGCAGTGGCTAAAGGGCGTTTCTCCTCCCTAAG
ACATTACGGAATTTTGGCCGCTTCCCCTCCCAGTGTAGAGCACGGGAAACATGCAGTAAA
CAGCCGTGGCGCAGTCCGCGTTCGGTACAGTGTAACCAGGACCCGAAGCTTTATTTTTGG
TCAACCACAGGAGTTGGGGGTCCTTGGCTTCAGTTGGGGAAGGGTTGGAGGCAGCGGTCT
CCACTCGGCCACGGCGCGGAGGCGATGGGACCGGACCGGCACGGGTGCCGGCGAACCGTT
GGCATCGCTCTCGCCAGGCCGCTCCGCCCGCGTCAATCACCCGGCTTGCGCATTGTTGGG
GGCGGAGCTCGTCGCCCCGAGCTCTCGCGAGACGCTCCGCCGCCGAAACGGGATCCCCAT
GCGCTGGGGCCTGGGGGGCTGCCTTTCCGGACATCCGCGGCCCCCAACCTTTAGGGAAGG
CGCGCAGTGTGATATTCGTCCTGCAGCTGCTGCTTTAACTTGTGCAGGGGAGGCTAATGT
GCTGAGACGGGTTGCAAAGGGCTATCCCTTTAAGATGCAGTTAAGGTGGCTTGGAAGGGA
TGTCTGACTGCAGTATTCTTGTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCG
ATGGTGTCATCGAGGTAAGAAACGGTTGTGGATGTTGAAGCTTTGAAAAGGTGAATGTGT
TCATCTCACTCATGCGTGCATTATTTTTTCTAACTTACAGAGCAACTGGAATGAGATTGT
TGATAACTTTGATGATATGAATTTAAAGGAGTCTCTTCTTCGTGGCATCTATGCTTACGG
TTTTGAGAAGCCTTCCGCTATTCAGCAGAGAGCTATTATTCCCTGTATTAAAGGTAAAAG
AAACTGGAATTTTTAGGAAATGACTTTATTCTACATAGTCATGGACCGTAAAAGGGAAAG
TAACCTCTGGGGGACTAGCACCTGTTTGTATTCCTTAAAGTGAAATGATGGCAATCATCT
TTCGGGACTGACCTGAAATGAAGAGAATACTCATTGCTGATCACTTATTATTTGGGCATA
ATTCATGTTCCAAATGGAATACATGGTGTAAAGTAGAAGTGACAATTTGATGTGGGATCG
GTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTAC
TGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGA
GACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTA
GTTCAAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAGAATTTA
AAACTTAGTATAAATTGGTCCTACCAGATCCTTCCTTTTAATTGTCCATGCATGCAGGGA
GTTTTTGTTGAAAGCTTTAAAAGAACTGGGTATGCAGGTATGGTTTGTAGGGTTGTATAC
TAACAGATTGAGAATCCGAAACACTCTTGGATGTACTAGATCTGTCCCCATTTTTTAAGT
TTGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTACCATTTGACTGTCTCCGT
AGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCTCACTGCTATATTGGCTTTGA
AGTAAACCTTCCTAATAAAGCTGGAGGCTTTATTGAGGTCAAGATTATATAAAGCACAAT
ACCCTCTGGGGGAAAAAAATTATTTGCCCTAGCTGTAATTACAGAACATATATTTCACTA
TGTACTCCCTACACACAGTGAAGAATAATGTAGGAAATGTTATTCTTGAATTGTCTAGCT
GATGCGTGGGGCAGCAGCATCCCAAGTTTGACAAGGCAGAAGAAAGACATTAAGGGAGTT
TTACCTTGAAGCAGTTAGGTCAGTCTGCGTTTTAAGCTTGGAAGTAGTTTCGTGCTGTGC
ATGCATAAAAGCTGTTGGCAGACCAGTTTAAATTTGCCATTATGCTTTAAAAAGTAGTCA
TTGATCCTGGAGTTCTTCAGGATAATAATTAAGGCTTGGTTTTTAGATCCAAAAGGTAAT
TCTGGCACTTGGAGACTATATGGGAGCAACTTGTCATGCCTGTATTGGTGGAACAAATGT
TCGAAATGAAATGCAAAAACTGCAGGCCGAAGCACCACATATTGTTGTTGGTACACCTGG
GAGAGTTTTTGATATGTTAAACAGAAGATATCTTTGTAAGTATTGTCTTTAAAAGAGTTT
TTTTTTTTTTTTACTGTTACAGTTGAAAAGTCGTCATATTACTGAGTAGATCTAGAAGTG
ACAGTATGACTTTGTTTCTAACAGCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAG
CAGATGAAATGTTGAGCCGTGGGTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAA
ACACAAGTATTCAGGTAAGCATTACTTCACTCCCCTCTTAAAGGTACAGATGGGGTTTAA
TGCAGGTACTGTTACAATACAACTGACGTGTTTTATTGTCGTTCCCCCTGCTTAAAGCAC
TTGATGCATAACTATCTTTGTCTAACTCCATTCTGTAGTGAGACAGAGACGCTTGGCTTC
AAACATTTTCTCTTGGGTATTACTGTGTAAGTTGTTCTACAACATAATTTTCTCTTTTCA
AGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCA
TGAGAGATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAAC
AGTTTTATATTAATGTTGAGAGAGAGGTAACTGATTGTTAGACATTATTTTACCTTCTTG
TATAAGCACTGTGCTAAAATTGCAGACACTAGGACTATGTCTTGGTTTTTGCAATAATGC
TAGCAGAGTACACACAAGAAGAAAAGTAACAGCACTAGATTGTAAAGACTGGGATGGACC
TCTTTCTTAATGTCCAATGTCCTTTGTCTTAAGATTTGGTGCAATATCTCATTAGACCTG
ATAGAATGAAGTTAATTTTTATAATTTCTACGTTTTGAGACTGGCTAAGAGGGGCCAATT
TTGGTATTTTGGGTAGAGACAGGGTTTCACTATCTGGAAACTGGTTGGAACTCCTGGGCT
CAAGTGTTGGGATCCCGAAGTGCTGGGATTATGGGCATAAGCACTGTGCCTGGCCCAGAA
TGTATTTTTAACTGAAGAAAGTTGGAAAAGCTAAATGACTGTTAACTTTCTCTTCTAAAC
ATTATAGGAATGGAAGTTGGATACACTTTGTGACTTGTACGAGACACTGACCATTACGCA
AGCTGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTGACTGAGAAAATGCATGC
CAGAGACTTCACAGTTTCTGCTCTGGTAAGAGGTGTTCTAAAATGTCTGGATTTCCACTA
AAGCAGGATTCAGACTACAATATAGCTGCTAAGTGCTGTGTTGTCGTTCCCCCTGCTCAA
AATAAAGTTGTTTCTTAACTATACCTGTCTGCTATATCCCTGTAGCAGCCAGGGACGCTT
GGTCTCATACATGTTGATTAAAATTACTGACCTGACTGGTGATTCTTGAATTAAGGTTTA
TTAATTTGCAGCATGGTGACATGGACCAGAAGGAGAGAGATGTTATCATGAGGGAATTCC
GGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGTAAGTCTCTTAATGCTTT
TTAAAAATCTACCAAAAGTTAGCTTTTTGGGGGGAAGGTTTTTAAGTAACCTTTGCCAGC
TTGGGCTATTTGGAAGAGTAAAAGGACCACACTCCACAGTGGGCTATACCACTTAGTATA
GTTCGCTACTATTTTGTGGCCTACATGACAGGTACCATGTTTTTTGAATTAGAATTTTTA
ACATATGCCATTGTGTTTCAGGCTCGCGGGATTGATGTGCAACAAGTGTCTTTGGTTATA
AATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGGTGAGAAGCCAGCATCTTG
GATGTATTGAAAAAAAATTCATACATTTTTCTACTGTGATTTGTATGAAAGGTAACATCA
AATCAAGGAATAGATTCAGTCAAGTCAGTAGTGTTCAGTAAGATGATGTAATTAAATTTG
TACTAGGGGAAGGCTGACGAGAACAAAGTGGGAAAACTTGTAAACATTGCTCAGATTGTG
GGCATAGGTTTTTTTTCCCCCCGCAATTGTTGGTCTTAGCTTATGCTTGAGCTTTTAGTG
ATGTTCTTGTGTCCATGTGCTTTTTCTTGATTTTTTCCATAGTTGGGATTTTCTTGGTGT
CGCCTGGTAGCAATTTGAGTGAACCCTGGTTTAGTTATAGTGGCTTTATCCCTAAATAAA
TTGAATCGTACTTTGTTATGTGATGTAAAAAAAGACTTTTTAAAAAATACAGGAGTCGAT
AGCAGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTAGGACGTGGA
ATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATTTGTTTT
TCTTTTGTCATGATTATTTATTTTAAGTTGCTCCAGCTGAGGCATCTTTCGTATTAGTAT
TTCTGTTAGGGAACTTTTCTTACTAGGTGGTTTGTATTGTCTGGTTTCTAACATGAAGGT
AGCTGTTTGGCGGTTAAACACGTTTTGAGTAATTTGAGTTACAACGTGTGAAACTGAGCA
AAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATATTTGTTTTCCCACTGGAAAAAAG
TAAGTTTTAGAAAATAGTTAACCTTTGCAGCATTTGTTTACAGTTTACAGTTCCAGAAGT
GCGTCGAAATGGATTACATAACTGCTCTTTTATTCCTGGTGTTTACATCTGTCCCAGGCT
GACACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACTACCCCAAACACA
ATACTGTCATCTGCTTTATAATAATGCTCAAGATGCCTGATAAAAATCTCATTTTGCAGC
CAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAAAGGAAGATTTTTTTCTCTAGATAT
GCATTAGCAGCTAGTGCTCCAGTTAGAAGCACGAACTATAACCTTGATAAGTAAACAGCA
GCTGATGGTTAACAAGTGGATCGTCATGTTCAGTAGTTCATAAATTATGTGAGAAGTAAC
ATTCTGATTGTTTTTTTCTTACACAGAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGT
GTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTC
TACAATACTACAGTGGAGGAGATGCCCATGAATGTGGCTGACCTTATTTAATTCCTGGGA
TGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAACGTGCATTGTGC
TTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCAGAAATACAGA
TTTTGATAGCAAAGCGACATTAGTCGTGAGCTCTTGTGAGGAAAGTCATTGGCTTTATCC
TCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGGGGTCTGTAAAATCTTTCTTTC
TTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTATTAGATGTTCTCTATCATTTAA
TAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTATGTTAAAC
TAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAGTAGAAAGGCCTTTAAAATTTT
TTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTATTTATTCAATAAAGTATTTAAT
TAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCAGCAAGCAATCATCCTAGGTAG
GGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTAAA
TAAATTGTATATTCACTTTAAAGGTGCTTTTGGTCATTTTTATTACAACCCCCTTATTTA
CAAAACCCCACATCAAAATATATTCACTTTTTAACAATTCTGAGATAATTGCTGCATCAC
AGTTGCACAAAGGCTGATGAGTTGCAAATGTTCATCAGCACCATCTGCTAGGCATTTGTC
AACTTCCTACAAGAAAAATTTAAGAAATTAGCATCCTTCAGGTAGTTAAATGTTTAATTG
ACATGTGCAAAGTACCTACTTACGGCAAGTTTTTCTGTAATAATGGACTTCTGTTTATCA
GATAAATTATTCTCTACAACCACATCATGGAGTTGACTGACGAACTGAGTTGCTGCATGA
CCCTCATCTATTAAGTCCTATTAAAAAAAAAACTTTTGGTATGATCATTTAATACTCCTT
TCCCCAAAGTTAGTAAGCTGACTTTACCTTGACCACAGCTTCTAGTTTGTCAAAAGAGCC
ACTCTGACAGGCAGCAAATACTCCATCAATTTTCTCAGCTGGTATTACCTAGGTAATTGA
ATGTTCAGTATTAAAGATGTTTCTAGGTGAGACTAACACATACAGTCCCCCCAGTCCTTT
CTGTTCCACAGCTAAGTTCCATACTTAGCTAATGTTGTGATAACCCTGTAAAGTTGGGAA
GGCTTTGGGAGAACAGCCAGAGTAACTCCAGTCACCACTGAAGTAACCAAGGTGCTAACA
GTTGTGCTTTTAAAGCCCAAGTTTGGACACACATGGGTTATAGCTTGTTCTGGTCAGTGG
ATGAAGACTAGTGGCCAAGATCAGCCAAAGAGACTGATTTCTTTAAAGGGGAAGTGCCTT
TTCTCTAAAAATCCATGTAAATATGCCACTAATGAGATTGGCTTAAAAAGTCCACAATAT
CCAGAAAATTTAAGATGATTAGTGGTACCAGTCTTGTCATATGGAAGGCCTACGTTTTTA
AGTAGTAGTGGTTCTGAGGTGAGTTTTGACATGGGAGTATCCAAAGACAGGTGGGGTACT
CC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1888..1933, 2020..2152, 2426..2565, 3346..3514, 3624..3733, 3962..4105, 4567..4704, 4931..5020, 5241..5320, 6566..7341
1065..1093, 1888..1933, 2020..2152, 2426..2565, 3346..3514, 3624..3733, 3962..4105, 4567..4704, 4931..5020, 5241..5320, 6566..6707
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved