Macaca_mulatta Locus Q3YAI0_MACMU
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Q3YAI0_MACMU
Macaca_mulatta
Q3YAI0_MACMU
2
SNORA62, SNORA62
2695..2845, 5507..5660
7997
TGAATTTTTAGTAGATACCGGGTTTCACCATGTTGGCCAGGCTGGTCTCCTGAACTCCT
GGCCTCAAGAGATCAGCCTCCCAAAGTGCTGGGATTACAGCCACCGCGCCCCTTCAATTA
ACTACTATTTTTTGTTTGTTTTTTGGAGACAGGATTTCACTCTGTTGCTCAGGCTGGAGT
GCAGCGCTGCAATCATATTCACTGCAGCCTTGATCTCTGGGCTCAAGCTATCCTCCCGCC
TCATCCTCCTGAGTAGCTGGGACTACAGGAACGCACCACCATGCTTGGTTAATTTTTGTA
CTTTTTGTGGAGACGGGGTCTCCCTATGTTTCCCAGGCTAGTCTTGAACTTCAGAGCTCA
GGCAATCCACTTGGCCTCTCAAAGTGCTGGGATTATAGGCACAAGCCACCGCGCCCAGCA
AACTTATCTCCTACTGACAGATATTGCAAAAACTTTTCTTCGACCAACAACAACAACAAA
AAAGATAGGTAGATGACAGATATAATCCATACCATCTGTTCAATCTTGTCCTTTTTAACT
TTTTCAGGGAAACTTCCCCTAAGTGAACATTTAAATCTGAATTACTTTCTGTTAAACTGT
TCTCCAGGAAAATCAAATAAATCTTCAAGCTTTTGTTTACCTAACAGTTTGTTGTGTCGA
ACAAACCTTTCTACGTTTCAGGTAAGGAAACTGCAGCTTAGGCGAGAAAGCCGCTCAAAT
TCGCAGGTACAAGGAGCTGGGTAAGAACGCCCCGCCTGGCTGGCTAGCTTCAGTTCCGCG
CTCTGGACAGGAATTATGCACAGGGCGCCGCTGTGGCACTGGAACCCCCAAAGTCACAAG
CTCCCCAGATCCTACCAGGCCGCGGCTACCCGCTACAGCCCAGAAGTCCTCGCCTGCGCC
GCAAGCCCGCCTTCCTGAAGAAGGAGCCCAGTCCCGGCAGCGCTCTTCTCCGGCTCCGCC
CTTCTTCCGCTCGACTTTCTTTGCCATTGGCTGACAAAGGAGTATATAAGAACGTCATTT
CCTATTGCTGCTCCTTTCCGCGCTACCTACAGAAGGGTCCATACGGCGTTGTTCTGGGTG
AGTTACTTGTGGTGTCCGTGGCGCCTCCCAAGGCTAGAAAAATGAGCTTTTCCTGCTCAA
GTGAAGGGTGCGAAGACTAGTTATGAAAGCCGGTCAGACCGGGTCTGTCTCCCGCCGGGC
GCGCCCCACCTTAGGCCTGCGGCCTGCACGTGGCCAGGCTCCGGCTGGCGGGTTCCCCCA
GTGCCCCGGGAGCGGGTGGAGGTCGCCCTCCAGCGGAGGCTCGGAGCTGGGGTTCGGGCC
AGGCCGCCGGTGGGCGGGAGTTCAGAAGGCGGACTAACATTCGGTGTTGCTATCCCTTCG
GACCCCCCCACGGCGGCGAGTCGAGGCCCAGGCCCTGATTTACACCGGCGACTTGGACTG
GTTGGGTTTTCCCCTTCGCGCCGTGTGGGTCAGGAGTTAAGGTTCTTGGGTTTTGAGACA
AGTGGTGACGGCACAGCGAAGTAATTCCAAAGCACCCGCCTACAATCTGCTTGAAAATAC
CTGAAACCAATTCATACGTTTTTTCCCTTTAGTTTCCATATTCCAAATATGGCTCCTCTT
GTATATCTAGTTAACTTGGCGTATCCGGAACTTTTCCTTAATTCCTATCTTGAGAAGTGT
TGAATTTCCATTCGCTAATTTCGTTTAGTTTTATTATTCACTTGTTCTGCCGTCCACATC
ATTTCCTCAGTAAGATGTGCGCTATTCCGTAATACACGACATGTATTGGTTAACTTTGCC
CCTTCATTGCACTGTAAGCTCAATGCCTGACACTGTAGGAGATGGAGTCTTGGGTAGCTT
TTAAGGGTGTACCCCACTTAATTTACTGGAATGAAAAGAAATAGATTGCTCTCCTTTCAG
ATTCCCGTCGTAACTTAAAGGGAAACTTTCACAATGTCCGGAGCCCTTGATGTCCTGCAA
ATGAAGGAGGAGGATGTCCTTAAGTTCCTTGCAGCAGGAACCCACTTAGGTGGCACCAAT
CTTGACTTCCAGATGGAACAGTACATCTATAAAAGGAAAAGTGATGGTTAGTCATTGCTT
TAATTTTTTGTTACTCCAGCTGTAAGTACAGATTTTGAGCTTGCTTATTCTCGTGGTTAG
TTCTGGGTAATTTCTTTGTATCATCTCTTCCTCAAATGAAACCAGACTCCTAGGTTGAAA
ACATACTTTAAATAAATGTTCTGATTGTTATTGGGAGAAAAGATTCCTGCTCCAGGGGAA
GAATACATCAGTTGCCCGCGTTATGGGACTTGGGTTGGGTTGTGAACTTGAGCAAGTTCA
TGAGCTGAGTTTCTAATAGCTCCCATAGTGCCTTCAACTTCATAGTTACTTACACAGGCT
GTTGAACTGAATTTTGAGTGGAAAGTGGGGCAGGAGGTGGGGATAAACAATATAGCTTGG
AAGAACCAGAGGAGGGAAGGCATTAAGTTGGCTAAGGCACTTATTTTAGAGATAAAGCTA
CCAAGGACTTCGGAGTGACATGCTGTGAAGGAGATTTAGGATGAATCTTGCATCAGTGAA
GATGATAAAAGGGAAAGAGTGGCAGAAAGTCAGGAAGTGGATTCTTAAGAACCACTGATG
GACAGGAAGTACAGGGAAGGAGAAAGGAGAGATGGATTTAGCCAACTGAATCTCGGCTGC
ACACTATTAAAGCTCAGGGTGGAGGCCAGTCTTGGCTCATGAACTTCTGAGTGTCGGAAG
TGTGCTACATTAATGGCAGGATTTTCGCTAACACCAGTAGAGCTTGCCTCTATGACTGGA
GTTTGGTAGTACTCGCTGCCACATACACTGAACTTGCAAAGAATGATTGCACAGCCAGGT
CAAGTGTTACAAATCCTTTTGCCTTCGCTTAGGCATCTACATCATAAATCTGAAGAGGAC
CTGGGAGAAGCTTCTGCTGGCGGCTCGTGCCATTGTTGCCATTGAAAACCCTGCTGATGT
CAGCGTTATATCCTCCAGGAATACTGGCCAGGTTTGTGGGACAGTGATTAGATTTTATAT
TATAGAAATGAAGCTTACAGACATTGTGAGAAATACAGAAAGGTATAAGAAAATAGAAAT
AACTCAAATTCCACTGTTCAGAGATCTTAAGTTGGACTGAGCCATAGAAGTCGCCGTTAT
GGCCTTTCCTCTTTTTTTTGTTTTTTTGTTTTTTGTTTTTAAGGCAGTCTCTTGCTCTGT
TGCCCCTTGCCCAGCCTGGAGTGCAGTGGTGTGATCTCGGCTCATTGCAACCTTTGCCTC
CTGAGTTAAAGGGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGTGC
CACCATGTGCAACTGGTGTTTGTATTTTTAGTAGAGACGTGGTTTCACCATTTGGCCAGG
CTGGTCTTGAACTCCTGACCTCAAGTGATCCTCCCACCTCAGCCTCCCAAAGTGTTGGGA
TTACAGGCGTGAGCCACTGTGCCTAGCCTGTAAGACCTTTTCAACATACATGCTGGGCAT
CTGGCAGTATGTTGAACTTTATAATTTCATTCTGTGTAGACTTCTGTCACTAAATATCTA
GAAATTATCCTATTAAAGTGGCTTACCACTTTTTCCCGTAGTCAGAGTTTTTACCTTAAG
ACGACGAAATACTGGGACAGAAATTTGGTATCAACTGCAGCATTTTTCAGTAAGATTTTA
TTAGATTAGGACAGTAGTCTTTGTCTTATCCAAGTTTCATAAGCAAAAAATTTTTAGGAA
TCTTAGCCAGTCATGGTGGCATTCACCTATAGTTCCCATTAATTGGGAGTCTGAGGCGGG
AGATCCCTCAAGTCCAGGAGTTGGGGGCTGCGTGCAGTAAGTTATGATTTTGTCACTGCA
CTCCAAGCCTGGGGCACAGAGTGAGATCCTGTCTCTTAAAAAAAAAAAAAAAAAAAGGCT
AGTCGTGGGTGGCTCATGCTTTTGTAATATGGGTGCTTTGTGAGGCCGAGACTGGTGGCT
TGCTTGAGCCCAGAAGTTCGAGACCAGGGTGAGCAATGTGGCAAGACTGTGTCTCTACCA
AAAATAAAAACCAGCTGGGTGTGGTGTTGCATGCCTGTAGTCTCAGCTGAGGCTGAGGTG
GGAAGATTGCTTGAACCCAGGAGGTTGAGGCAACAGGGAGCCAAGACTGTCTACTGCATT
CCAACCTGAGTGACAAGAGTGAGGCCGTCTTTGCCAACTTGAATGAAAAATACCTTAATT
TGTATTTTTAAGAAATGACTAGTTAGTACAACTTGAATCTTTTTTTTTTTTTTGCCACAG
CTCTATTTTAACATTTTTTCTGTTGAGAAAACTAGTAGATTTCTTGAATTCTAAGAATTC
TAACAGGATTTTATTCAACTCAACTATTTTGACAGATTTGAAAATCATGTAGTGAAGACT
TTATTTCAATGTTGACAGGACAGGTTCCGACGCGTGTTTTTGCAGAGGGTTATTCCTGAA
ACTGACTTGTTACTGGGACTGCATAGTTTGGTACACAGTAGAAAAAAGGCATTTTTAGTT
ATTGCTGTAGAATGAACTGAGTGACAGTTCTTGCTTGCTTGAGAAAAATATACTGAGCAT
CTAGATTGGGCCAGGTAGTGTTGCTGGGTGCTTGGGATATAGTAGAAAAACAAGCCTCTT
TTTGAATGTATGCGGGAAATCTCCCGGAGAAGTAAGAGAGGTTAAGGAAAGCTGGGTATG
TGCCTGCTTTATATGGAGTAGTAGTGATTAAGTTGGCCAGTGCCCAGAAGTGCTTCTTGC
TGGTGCCAAGATTGTTCTGTGTTAGATGTGTTCTCACAACCATGTGAGGAACTTGGAGGC
ATGTGAATGTCCTCAGTTTACTCAAAAAATCACCTACTTGGTTCTTAGAGCCTGGCAAGT
GTGGTTCTGGAGCCTCCAGACGTAAAGAAGCCAGTGAACCAGACACCTGAGAGAAGTGGG
GGTGGGAAGTGCATTCCAAGCAGAGGGCCTAGAAGTGAGGGCATTGTAAGTCAGTTAACC
TAGAGAACTTAGAGGAATTAATGCTTTTTGCTTTCATTTTTGAGGAAGAGGTATTTGAGG
GTTTCGGCCAGATAGGCTTTTTCATATGATTACAGAACTGGTGTCAGCATATGGGGAGTT
GCTATGAAATATCTCTGGAGTACCATTAACTTTTAAATTCTTCAAAGAGGGCCGTGCTGA
AGTTTGCTGCTGCCACTGGAGCCACTCCAATTGCTGGCCGCTTCACTCCTGGAACCTTCA
CTAACCAGATCCAGGCAGCCTTCCGGGAGCCACGGCTTCTTGTGGTTACTGACCCCAGGG
CTGACCACCAGCCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGCTCTGTGTA
ACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGTAATGA
TTTTATGATCTAGAATTGACGAATGCATGCTCTAGAAAAAACATTCCTGTGCACATTGTT
AGAGCTTGGAGTTGAGGCTACTGACTGGCCGATGAACTCGCAAGTGTAGGTAGTGTGCTA
CATGAGGGGCAAGTTTTTCGCTAACACCACAAGGGTCTTTGGCCCAATGAGTGGAATTTG
ATAGTAATTCTTGCTACAAGTATAACATTACTGCATGACAGCTTTGTGGAGAGATGAAAA
CATTTGGAAAATAGTGTGTTTTCTTCTGCCTTTGTCCATGTTTCTTGCTCAGGCCTCAGG
CATTTGGCCTTTCTGGTTTTACACCAACTTGATGGGTTCTACTATAAGATTCTAAAAAGG
TGGGTTGTGTGTGGTTCAAATTGGTTGATTTGTAACCCTAGTTGTGCATAAGAATTGCCC
AGAGATTTTTTTTTTTTTAAATGCTAGTGTCCAGGCATTTCTCCCAGAGATCTCATATAG
TAGTGTGTGGTGAAGTCTTGAAAACTGTGTGTGTGGGGTTTTTTTTGGTTTTTTTGTTTG
TTTGTTTCAATCCCTATGATTCCAATGTGCAGACAAGGTTGGTTGAAAATCCCTGATTAT
AATGTTCCCTGTTACAATTGCTTTTAAACTAAGAGATGTCTGTACTTTTGGTACCTAGAT
GATGTAGGAGCCAGGAAGATGCTTGCTGTTTGGGTTTGACCAAGTGTCACTTTTTAATAA
TTGCCGCTTTTGGCAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGA
AGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCGTGGGAGGTCATGCCTGATCT
CTACTTCTACAGAGATCCTGAAGAGGTAAGCTCCAAAGGCTTGTGGTTACATAAGCAATA
TGGACAACTTGGACTGTGCTTCTAGGAAGCAAAATTTGTCAGTCACTGTAAGTCTTTCCC
CCCCTTTTTTTTAAAATAACCAGATTGAAAAAGAAGAGCAGGCTGCTGCTGAAAAGGCAG
TGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCAGCTCCTGAGTTCACTGCTACTC
AGCCTGAGGTTGCAGACTGGTCTGAAGGTGTGCAGGTGCCCTCTGTGCCTATTCAGCAGT
TCCCTACTGGTATGTATCAGGATAGAAGAGCATCAAGCTGATATTTTGCAACTTCTCAGT
TTTATTCTAATGATCTCTGTGGCTTTTATAGTAGCTTTAAGAGGTTTTCATCCTAGTGTG
CTACAGCATCTGATAGTCTGCTGTAGGGAGTGGGGTAAGGAAAAATACTACTTTGAGGAC
AGAGCTGATGGCTTTTTTTGGTATTTTCTTAACAGAAGACTGGAGTGCTCAGCCTGCCAC
GGAAGACTGGTCTGCAGCTCCCACTGCTCAGGCCACTGAATGGGTAGGAGCAACCACTGA
ATGGTCTTAAGCTGTTCTTGCACGGGCTCTTAAGCAACATGGAAAAATGGTTGATAGAAA
ATAAACATCAGTTTCTAAAAGTTGTGTTTATTTAGTTTGGTTTTTTACTCCAGATCAGAA
TACCTGAGATTGCATACCAAGGTATAATAATAAATACATGTCTCGAAATGAATTGTACTT
CTAAAGCCCACTGTAGATAATGTACATTGCTTTTCACTTGAGCTTGCTTTCTGTGTAGAG
AACATCTGTTCCCTGAAAATAGATATAAGTGGTTGCACATACTTAGGTGGTAACCTCAGG
AATATTTTTCTGAGGCCCTGATAATCTTGACTTTAATTACCATTTGTGTAGGTAAGTTCT
ATAGAGCTTAGGTTTTTATTTTTGAGAATGTTCCTGTCACTTAGGTTAACTATTCCTGGA
AGCCCTGGACAGGCGATGGCCCTTCCCCACATCGAGAGACATTAATTGCCCCTCTTGTGA
GCTTGCCTACAGGTTCTGGGAGAGGAGAGGGTTGTATGTATGTATAAAAAAAATAAATGC
TCTCCGTATTTGTCTTTGCTGGGGGTGGGGCGGGGGAGAGAGTCTTTACCTGTTGTCCAG
GCTGGAGTACAGTGGTGTGATCTCAGTTCACTGCAACCTCTGCCTCCTGGGTTCAGGCAA
TTCTTGTGCCTCAGCCTCCCGCATAGCTGGCATTTCAGGTGTGCACCGCCACACCTGGCT
AATTTTTCCATTTGTAGTAGAGAGGGTTTTGCCAGGCTGGTCTCGAACTCCTGGCCTTAT
GTGACCCGCCCCAAAATGCTGGGATTACAGGCCTGAGCCGCTGTGCCTGGCCACATTTGT
TTTTTATATGTTAATGCTGCTGACTTCATCCTAAACTGATTTAATGATTCTCATTGCCTA
TTGAAAAATACTCTTGGCTGTCATGTTGGCTCACCCATAATCCCAGCACTTTGGGAAGCA
GAGGTAAAACAATTGCTTGAGCTCAGGAGTGCAGCACCAGCCTGGGCATCATGGTAAAAC
TCCATCTCTTCGAAAGATACAGAAAATTGGCAGGGCATGATGGCATACTCTTACAGTACC
TCAGCTACACAGGAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1920..2085, 2912..3030, 5207..5452, 6196..6324, 6443..6608, 6815..6997
1953..2085, 2912..3030, 5207..5452, 6196..6324, 6443..6608, 6815..6906
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved