Macaca_mulatta Locus ENSMMUG00000001340
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000001340
Macaca_mulatta
ENSMMUG00000001340
2
SNORA7
2032..2170
7433
TGCCTAGGCTGGTCTTGAACTCCTGGGCTCAAGCAAATCTCCCGCCTCAGACTCCCAAA
GTATTGGAATTACAGGTGTGAACCATAGTGCTCTGCCAATTTTCACAATAATCTTAAATG
CAAAAGCTAAGCAAAACGAATTAAGAGTAACTTTAAAAACTAGGCAGTCTGGGAGGCAGT
GGCTGCAGTGAGCCGTGAGATGGCGCCTTTGCATTCCAGCCTAGGTGACAGAGGGAGACC
CTGTCTAAAAAAAACAAAAAAACAAAACAAAACAAACAAACAAAAAACAACTAGGCAGTA
GCTCGTGCCTGTAATCCTAGCTACTCAGGAGGCTGAGGCGAGAGGATCGTTTGAGCCCAG
GAGTTCGAGACCAGTCTGGGCAACAAAGTGAGACATCATCTCCAAAAAATGAACAAACAA
AAACTAGGCCATTTAGCATAATGATTAGGGCATGGAGTTTGGAGTCAAGTCTCCAAATTT
CACCTTCCACATATGCAAAATGGAGACATAATAGGGGTACGTTATAGAATTGTGGTAGGC
ATAGTGAACTCCATCGCATGTTAGCTATCATAGTTTCGTTACTATTTACTGTCTAAATTC
GGTGAGGAAATTATTAGGAAGTCTCTGTCTTGTTCTCTTCTGACCACTAAGAGGCGCACT
TCGGAGTAGAAGAAACGCGGGCGGAAATAGCCCAAAAGCGGATTGGCTTCAACTTCTGGC
GGAAGTAAGTTCCTCCCTCCACCGGGTCTTATTAGCTCATAAAGAATTCCAAATTTCTAC
GTAGACCCAAGGATAGGTAGAATACATTTTTCAGTCATATTCCTAGATATTACGATCTAT
TAAAACATGTATACTCAGAATTTTTTGCGGCATTATTTTTTGACGTGTCTTTATTTTATT
TGAAAGAGCCGAACCGGAAGTGCTTGCCTTTTCCCTGCCAGGACCCAGGGGTTTACGTCC
CATCAGCCCTTGCGTGCCACTGTTCTTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGC
AGCCATCTCCTCCTCGGTAAGTCTTAATCCGTGGCCATCTGCATTCCTGCGGGATTCATC
TGGCCCCATTGCCCAGTGGTGCGGGGGCCTCCCCTTCGGCGCGGTAGTGGCTGTGGGTAT
TGTTATTGTCAGCTTACTGGGGCGTGTACAGGAGCAGAACGAAGCAGCCCGGGTTGATGG
GGCTTTGCGTCCCAGAGCCTCCTGCTCTCCGCTTGTAGTCAGAGCTGCGGGCTGCTTGTT
TGTTCCTTGGCGGTGGAGGGTGCTAGTTGAGCCCAGACTGCGGGGTCTCCTGTGGGCCGT
GGGACGACCAGGGGTGTCCCAGCTTGACAGCCGTCAGCTGGGATCTGTGGATCCCAGCGC
TCACCGATGTCGGCCCACGTGTATTCGTTCATTGCTATAGCCCGCTTCTTCGCTGCAGTC
TCGGGCCCTAGGGGTGCTGCGGCTGCTGGTTCAGTTGCAGGCAGAAATTCTGGTAGTATC
TCTGGAAATAAGATGCAACTGCCCCCACCTTGCCTTCGAGGATATCATGGGCCAGAAGGC
AAAGTCGTTTTGAATACGTGGTTCACTGATTACCCACTCTGTGCCAGTTGATGGCTGCGA
ACAGAAGGGGTGCTGCTCTAGGAAATAAATGAATGGCTCTGAAGACCACACTGAGGAAGG
TGTGAGTTGATACTGCAAGATCTCCAGGTTTGAGGCATCCTTAGACGGATATGATGGTTT
TGTGTGTGCTGAGGGTGTGGTAGCGCAGCAGCTCCCTAGGGAATTAGAAGGTTTTCTTTA
TTAAACGTTTACCCTGTGACAGGCACTGCAGGCATTCAGCGTGCAGTGTCATCTCTATTC
TACAGGTGAGGAAACTGAGACTCGGGTCCAAGTAGTTGGTCAAGGCCATCTTGGGGTTCG
GACACTGGCGAGGTGGGATTTGCTGCCCCTTGCAAATTGAGTGTCTTGGGGTCGGTTTTG
ATTTGCTCAGCTGTTGGCATTCTTTGGGCTCTGAGTGGTTGAGTTGACCTTTGACCTCCT
GGGATCGCGTCTGGAGAGTGCCTAGTATTCTGCCAGCTTCGGAAAGGGAGGGAAAGCAAG
CCTGGCAGAGGCACCCATTCCATTCCCAGCTTGCTCCGTAGCTGGCGATTGGAAGACACT
CTGCGACAGTGTTCAATCCCTGGGTGGGAAAACCTCCTTCCAAGCCGCCTTCCAGGATTT
TTCCTCACCTGGGGCTGCTTCTTTCCCAGAAGGCATCATGGCCGCCCTCAGACCCCTTGT
GAAGCCCAAGATCGTCAAAAAAAGAACCAAGAAGTTCATCCGGCACCAGTCAGACCGATA
TGTCAAAATTAAGGTATGTGGTCCTGGGATGGAAATGGGTGTGGGGTGAAGAAAGAAGTT
TCCAACAGGCTGTCGGTTTCTGACATCATCTAGTCGGGATTACCTTTGACCAATGAACTG
GTTTGTGGAAGAGCTTTCTGTAGAAATACAGGTCTCCCCCAGTGTGCCCTAGTGCTGGTA
CTTAACATCTCTTGATGTGTTAAGTGAAATTTAAATGAGAAGGGACACTTGGCTGTTTCG
ATGTGTTTAGAGGGCTTTGCATTTGTCGTGTATTTTGGGTTGCCTTATGACAGCAGGATC
CCTATTTTATAGACAAGAACACTCAGAGGTGCTGAGAGCCGTGTCTGCAGCTGTGCTCGC
CATCTCAGTTTCTACACAGTCCCCTTGCATCCCATTGGTGCCTCCTCCATTGCTTGGGAG
TAGGAATGGTGGGGGTGCCTGCATTCCTAGTGGCTAAAGCCACGAGCTCCTGGTTTTTCC
CACCAAAAAAGTAAGGAAATAGTGAAGTCCTGTCACCAAAGGCAGCTACTGTGTGGCATA
CTTCCTTTTCATTTGGTTCTGTTTTCCCTCCCCAAAGGAACAGTTGGCACTCTGCACAGA
CGCTAACCCACCTGTGTGTTATTTCCTTCAGCGTAACTGGCGGAAACCCAGAGGCATTGA
CAACAGGGTTCGTAGAAGATTCAAGGGCCAGATCTTGATGCCCAACATTGGTTATGGGAG
CAACAAAAAAACAAAGCACATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAACGT
CAAGGAGTTGGAAGTGCTGCTGATGTGCAACAAGTGAGTTGGGTCCCACCTCTAGTTTTC
AGGGATCCGAAGTTTGCATCTGTGTGAGCACTTCTGGCAGGAACTCTAGAAACTCTTGGG
GGATGCATTTTGGCTGGGAGGGGTTGTACATTCTCTGAGGGAATCTGAAGTTGTTCCTTG
CGGGATTTTAGAGAATGCTTGTTGGGGAGTAAAGATTTTGGGTAGTTCAAGGTGTTTCCT
TTACCGGAGGGAGGAGGCTTGGTCTTCTAAGTGTAGAGACCCAAGACCAGGAAAAGACTG
CTCTGTGAACACTGCAATAATAACCACTTTCCACTACTACAATATCCTTTGGCTGTTGTT
TCCAGAACATTGCTTTCTTTATGAAGGTGTCAGCCAAAAGAGTTGAACTCTGAAATATTT
GAAGAGATTTATTCTGAGCCAAATATGAGTTGACCATGGCCTGGGACACAGCCCTTGGGA
GACCCTAAGAATATGGGTCCAAGGTGGGCAGGGAGCAGCTTGGTTTTACATATTTTAGGG
AGACATGAGACATCAATCAAATACACTTAAGGCATACATTGGTTTAGTCCAGAAAGGCAG
CAGTTCGAGGTTTTGAATAGATTTTCTGTTTCTCATCGGGAATTGGTTATCACTAGAAAG
GAATGTCTTGGCTATGGTAAGAGGTTGTGGAAACCAAGAGTGCCCTATTCAAGGAGGGAG
TGCATTCAGATGGTTGCTGGGGGCCTTTGAATTTTATTTTTGGCTTACAAGGAGGGTAGG
GAGAAGATCAAACATGGACCTCAGGCCTTAAGGGGCCCTTTAGTCTGTGCTGTGGTAAGG
GGTATCTTCAGGGACAGGAGGGCTTTAGAACCAAGTTTGGATTAGGTGGAGAACAGGAGG
AAACTTGGCAGGCAGAGAGTGCTTACACAAAGGTGTAGAAGTGAAAGCGCATGGAGGGTT
TGCAGGGCATTGGTTCTAGGTGGGTTTTATTGGTTTTTGTTTTTTTAAGATGGAGTCTCG
CTCTCTTGCCGTGGCCGGAGTTCAGTGGCATGACCTCGGCTCACTGCAACCTCCACCGCC
CAGTTTCAAGCGTTTCTCCTGCCTCAGCCTCCCATGTAGCTAGGATTACAGGTGTGCACC
ACCATACCTGATTAATTTTTGTATTTTTAGTAGAGATGAGGTTTCACCATCTTGGCCAGG
CTGGTTTTGAACTCGTGACCTTAAGTGTTCTGCCTGCGTTAGCCTCCCAAAATGCTGGGA
TTACAGGCATGAGCTACTGCACCTGGCCTGGTTTGATCTGAGAGAGACAGATGCATCTGT
GTTGCCCTGGCTACAGTGCAGTGGCTACTCACAGCTGTGATCGTGGCACACTGCAGCCCC
AAACTCAAGGTGGGCTCAAGCTGTCTCTTCCCATCTCAGCCTTCCTGGTAGCTAAGACCA
CAGGCATGCTCCACCATACCCAGCTAGTTCTAGGTGTTTTGAGTAAGTTAGACACTTGAT
GAGCTCTGTGTATAAGAGACTTGGTGACCTGCTTAGACCAAAACTAGGGCAGTGGAATGA
AAAATTCTCATGGGAAGTGACAGTTTATTTTCTTCACTTATTGGTAAATGAAAGCCAAAA
AGCTGAATTTTCCTAAGTAAACTAGAAAGAACATGGAGTGTGTGTGAGTAACTAGGATGT
TTGTGTTTATGTTTACAAAGATCTTTTATCTACAGTGGTTGTAGATATAAGTAATAAAAA
TGAACAAGAGCAGTATTCTAACGTGGTTACCTTCCAAGGCTGGAAATTTAACCAGGCGTT
GAAATGCTGAAAATTTCTGTTAAAAAAAGATGAGCATAGGAATTAATGGTGGACACTGAA
ACCACAGTTGAACTGTAACAGGCCAACATGATTACTCAGTTGCAGTGCACATGTTGGCTG
GTTGCCATATGCTCTGTAAGTGCAGCTTGGCAGTCATTTTAAGATCCTTGGAAATACTCT
GTTATCTCTGACCTTTGATCTCTAAGTTCCATTTCTGGGCATTTGTCCTTAAGGAATGGA
AAAGCAGGGAAACAAAAGCTAGTCATTGCAGCAGTACAGCTGGAAACAACTGAAAATATA
ATGAGAGAATTGTAGAGTGCTGGATAGAATGTTGTGAGTCTATTCAAAATGATTGGCCTG
TTGTAGTATGGAAAATGCCCAAGCTAGGGGGACACATTTAAAATGGTGGGTACACTCTGT
AATTATCAAATATGTAGATGGACAAGGACAGGAGAGTTTTTTGAAAAGGACAGATGAGAA
GTGTAATATAAACCTAAGCCTTTGAAACATAGAAACATTTAAAAATATAGTTGCTTTGAA
TTTGAGTGGACTAATGTAAAACAAGAATTGTCTGGATTTGCTGTCTTGCTGTTAAGGCAG
GGTTCTTGAAAAGAGCTGTGTGTCCACTGCCTCATTTAATCACTCCTCACAGTCCTGCTG
CTTCTCTCTTTGCTGAAAATGCTTCAGGGGTGGAATGTCTGTTCTTAACCCACTGTGGGT
GGCTTCATAAATCACCTCCTTACTGAAGTGTGCTTGTTAGGCCAATTGGTTATCAAATGG
GATGAGTTAGAACTGGATCTGGCACACCAAGTCCTCAGGTATTAGGCATGGCTATGACTG
GGTGACTTTAAGCATTGTTGCTTCTACTTGCTTTGTATCCTCAGTGGTCAAACTGGGTGC
TCTTGGCTCCATTCAGACTCTTGGGTTCTGCTCTTGACCACTTTGAAGAGTTCTGAAACT
TCATGGGCAAGGTAAAGCACCCTGCGACTGGGGGAGAACCATTGAACCTGGAGCGTGGGC
CTGGGTTCACCCTGGATCCCTGTCCATTGCTTGCTGTGGGCCTTGGTTTCCTTATCTGTA
AAATGGAGGTAATGCCTGGATTACAAGGCTGCTGTAAGGATTAGATGAGAGGGAACAGTG
AGGATACTTTGTAAATGAAAGTGTTCTTGTCATCACCAGGGAACCATAGACTCGGGAGTC
AGGATTTGGGGGCATGTAGGTGTCATTCCACAGCCACATACCAAGCAGCCCTCTCTTAGC
TTGGTGCTGGGACTCACTGCCTTCTTAATCGAATTTTCCAAGTGTGTTCAGGGCTGTCTT
GCTCCTTACCTACTTGATTCTCTTACAGATCTTACTGTGCCGAGATTGCTCACAATGTTT
CTTCCAAGAACCGCAAAGCCATCGTGGAAAGAGCTGCCCAGCTGGCCATCAGAGTCACCA
ACCCCAACGCCAGGCTGCGCAGTGAAGAAAATGAGTAGACAGCTCATGTGCACGTTTTCT
GTTTAAATAAATGTAAAAACTGCCATCTGGCATCTTCCTTCCTTGGTTTTAAGTCTTCAG
CTTCTTGGCTTAGTTTGTCACAGAGATCGTTCTTTTGCTTAAACCCCTTTGGCATCTCCC
ACTTGGAGGGGATTTGTAAAGGACACTCGGTCCTTGAACAGGGGAACGTGGCCTCAAGTG
CACAGTTGAGGCTGGGGATGAGGGGCACAGACTAGGTAGGTTGTAAGACACTTGGAGAAG
CTGTGGGTCCCAAGCCACAAGTAGTCATTCTTAACCTTGCTTTGTAAAGTTGGGTGACAA
GTTATTCCATGTGATGCTTGTGAGAATTGAGAAAATATGCACGGAAATACCCAGATGACT
TTCTTAAACAGATTGTTATGGGATGCCTAAATTGCATCCTGTAACTTCTGTCCAGAAAGA
ACAGGATGATGTACAAATTGCTTTTCCAGGTAGTCCACCACGGTTACTGGAAAAGCACTT
TCAGTCTCCTGTAACCTTCCCACCAGCTGCTGCTTCAGGTATAATGTTACAGCAGTTTGC
CAAGGCGGGGACCTAACTGGTGACAATTGAGCCTCTTGACTGGTACTCTTAGAATTTAGT
GACACGTGGCCCCGATTTTTCTTTTGGAGACAGGGTCTTGCTGTCACCCATGCTGAGAGT
GCAGTGGCACACTCACTGCAGCCTTGACCTCCCCAGGCTCAGGTGATCTTCCCACCTCAG
CCTCCCAAGTAGCTGGGACTACAGATGCACACCTCACCTGGGTAGTTTTTGAAGTTTTTT
TGGTAGAGATGGTCTAGCCATGTTGCCTAGGCTCTTGAACTCCTGAGCCTCCCAAAGTAC
TGGGATTACAGGCACCTTACATAGTATATATAGGTCATGAGGGATATGGGATGTGGTACT
TACGAGATGGAAATGCTTACAGGATGTTTTTCAGTAACCATCCAGTCAACTTACCAGAAA
TGCTGTGCTGGTTATAACAAAGCTTCTCTAGGTCTAGTCTCATTCTAGTAGATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1035, 2252..2352, 2971..3152, 6268..6433
2257..2352, 2971..3152, 6268..6394
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved