Macaca_mulatta Locus ENSMMUG00000015270
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000015270
Macaca_mulatta
ENSMMUG00000015270
1
SNORD55, SNORD46, SNORD38, SNORD38
1288..1367, 1907..2010, 3221..3289, 3762..3830
5109
TCAGCCTCCCTGAGTAGCTGGGACTACAGGTGAGCGCCACCATGCTCAGCTAAATTTTG
TATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGGCGGAGCTTGCAGTGAGCC
GAGATCGCGCCACTCACTCCAGCCTGGGCGACAGAGCGAGACTTCGTCTCAAAAAAAGAA
AAAAAAATACATATATATATTCTTCCAGCTCAGAAAAGTTAACTGATCCCTTCTTTATAC
TCTCTAAGTTCCGTTCATTCTGGTGGCATTTATAAACCAACGATTCCCAAAACATCTTCA
GTGCAGGTCCCTTATAAGGATGACCAGCTTCCTACCTGTCATTCCCACTTACATGACTTA
GCAAGATCTCAAAATGAACGTGTCCAGAACAGCTCCTACCTTAGGAGCCTACCCCATCTC
AGTAAGTGGCCCCAATATTTATTCGATTGATCAAGTGAGAATCTTAGGAATCCTTGACAC
CACCCTCTCCCTCAATCCCCATGTCCAACCTACCACCAAACCCTTCAAAACAAAACCCAA
GTCCACAGTCGTTTCCAACTCCATTGCCTTCCACCCTTTTTCAACGCAGCCGCACCCACA
TCTCATCCTAAACGACCGCAGCAGCCTCTGAAACTAGTCTCAACACGCCCGGATGTGCCG
ACGCCGCAGACCCCCTTCCCCCAACCCAAGGTCGGAGGCGGGTCAGTTAGGGTCTGCGGA
TGAAGGCAGCCTGCGGGAGCCTCCCAGACTCGTTGCCCTAGGCGCGGCAGCAAACACGTA
AGTCTAGTCGCCCGACGTTGTTTCGGCGCTCAGAAACAACGTAAAGTAAAGGGGCGGGGC
AGCGTTTTACAAACCGTACCGTGAATCTTTGCGATTTCTCTTTCCAGCCAGCGCCGAGCG
ATGGGTGAGTGTCGCTCTGCGTTTAGGCGCGTGATGGGGGGGTTGAGCTCAATCAGGCCC
CATCCTGCTTCACAGCCTACTGAGGAGTCCAGGCGCCCCGACCCCCGGCCAGGGACAGCC
ACAAGGAGTGGTGGCCCTCGGGTTTCGGCCGCCGAGCCCCTCTCTGGGGGCTGCGAAGGC
TCTGGACTCCGAGTTCCGGGCCGCGGGCTGCAGGCTCCAAGCGGCGCTAACATGGCTGCC
GCGCGGTGGTGGCCCCGGCCGGGCCGCACGTGTATGATGACGACTCGGTAATGCTGCATA
CTCCCGAGTGCGCGGTGGGGAAGCCAACCTTGGAGAGCTGAGCGTGCGGCCTGCCGGCGC
GGGGGTCGGGAGCTGGCGAGTCGCTACCACCGAGTTACAGTGGCTCAAGCTTCCTTCCCC
GCTTCCACATGCAGGCATTTCTCGGGACAACTGGCACAAGCGCCGCAAAACCGGGGGCAA
GAGAAAGCCCTACCACAAGAAGCGGAAATATGAGTTGGGGCGCCCGGCTGCCAACACCAA
GGTGGGTGCGAGCGTGGGCCTGTCCGCCCGGGAGGTCGCCTTCCCCGGCTCTCCAGCGTG
CTCGGGCCTCTCCGTGTGACAGTTGTGCGTTCTTTCTTGGGCTCTGATTTCTCTGTAATA
GGGCCTGGGTGTCCTTCCCCCTTTACCTGCTGTATAAGTAAGTACCAAAGAGGGAATGCT
CCCTCAGGCCCCCAACCCCGGAGCTTAGGGTCTCAGAAGGATACTGTGTGGGGGACTTGA
GCTTCTGGAGAGGGTGGCACCTCGGCTAATAGAATCCTAGTCTTTTGGGTTTTTTTTAAC
AGAGGCTTAATTTTTAGCATTTGGGGTCAGGCTTTCCTCTTGGAGGCAAGTAAGGTGATG
AAAAAGAATCCTTAGGCGTGGTTGTGGCCGTCTTGGTCACCTGTGTGCCACTTGCCAATG
CAAGGACTTGTCATAGTTACACTGACTGTTGCCTCCTTCCTGCCGCGGTTCCTCTCCCTT
TCTTGCCTTGCTCTCCTTGGTAACCTAGTTCCTGTAACCTTGTGTTTTCCAGATTGGCCC
CCGCCGCATCCACACAGTCCGTGTGCGGGGAGGTAACAAGAAATACCGTGCCCTGAGGCT
GGACGTAGGGAATTTCTCCTGGGGCTCAGAGTGTGAGTGAGGCCCTTTGGGAGTGGGTGG
GAAAATGCACCTAAACCTTCTTAAGATTTACCAAGTGGGCCTGGTGCGGTGGCTCGTGCC
TGTAAGCCCAGCACTTTGGAAGGCCGAGACGGGCGGATCACCTGAGGTCAGGAGTTCGAG
TCCAGCCTGGGCAACAGAGCGAGACTCTCAGAAAAAAAAAAAAAAAAAGATTCAAGTGCT
TTTAGCAGGTAGTCTGTGGCTTAGACCAAGGCATTTGAAGTTTCTTCTTGCTGAAAGATC
TTAAGGTAGCTGGAGAGGTTCTCTCCACCCAGGCTGTCCTCCTTCAATCTCTTTTTTTGA
GACTGGGTCTCTGTTGCCCAGGCTGGAGTGCCAGTGGTGTGATCTTGCCTCACTGCAACT
TCCGCCTCCTGGGTTCAAGTGATTCTTCTGCCTCAACCTCCCAAATAACTGGGATTACAG
GCATGCGCTATCACACCTGGCTACTTCTGTATTTTTAGTAGAGAAGGAGTTTCACCATGT
TGGCCAGGCTGGTCTCAAATTCTTGGCTTCGCGTGAGCCACTGTGCCCGACCTGCTCTGC
TCTCTCTCAACTCTGCAGCCTGAGAGATTGGGGCTGATAAAGACTGGTTGCCAAACATCA
CTAGAAACGTGGGTTAGGGGTTTATGGAAGACGAACTGATGCCCCATGGCTTGTAAAGGC
TGGGCGTTCCCTTATTTCTCCTTAAGGCCTCATGGGGCTGAAGAACCTGGAGGGGTGTGC
CAGAGCCATTTGTCCTCCAGTTTACTTGATGCCAAATTTCTCCTGTGAGCAGGTTGTACT
CGTAAAACAAGGATCATTGATGTTGTCTACAATGCATCTAATAATGAGCTGGTCCGTACC
AAGACTCTGGTGAAGAATTGCATCGTGCTTATCGACAGCACACCGTACCGACAGTGGTAC
GAGTCACACTACGCGCTGCCCCTGGGCCGCAAGAAGGGAGCCAAGCTGGTGCGTGTTACT
TCTCTGTAGGGGTTGTGGGAAGGGCAGCCTGACTCCAGCCTTCTCGTGATGAAACCTCTG
TCCAGTTCTGCTACTGAAGGGAGAGAGATGAGAGCCTTTAGGCTGAGGAAGGCCAGCACT
GGGGTGTGCAGGGTTCGAAAAGGCTCCCAAGGCCTGCCTGCCTTCCCTGAGCTCATAAAT
TTGTATCCCCTTTTCAGACTCCTGAAGAAGAAGAGATTTTAAACAAAAAAAGATCTAAAA
AAATTCAGAAGAAATATGATGAAAGGAAAAAGAATGCCAAAATCAGCAGTCTCCTGGAGG
AGCAGTTCCAGCAGGGCAAGCTTCTTGGTGAGAAGGCTGTTGTGTTGGAGGTGGGGAGTT
GCAGAGATCAAGTGTGTTGAGTCACTTTTCCCTTGTCTAAGTCCTTTGCCAGCCATGTGG
TCTAAAGGGTTCACCAATAACAGGCTGTGAGCAAAATGGGGAATGTTTCACCGTCCTATT
CATGTGAGGCTGAAATGGAAAGCATTGGGTAGAAGAGCCTGCATAGGCCCATGCTTGGAG
TTTTAGTATTTGGGGAAGTCCCTTCCCAGGCTGAGGGGGCTGTCTCAGTGATGAAAACTT
TGTCCAGTTCTGCTACTGACAGTAAGTGACGATAAAGTGTGTCTGAGGAGACAGCTGGCT
TCATGCTTGCCCCTAGGATACCTAAACCCACAGAGATTCTTAAGGGGGTGGAGAGGTTTG
GGTGGGGCCACCTTGTCATGGAGCTAAGGATCACCTACTCTCTTCCAGCGTGCATTGCTT
CCAGGCCGGGACAGTGTGGCCGAGCAGATGGTTATGTGCTAGAGGGCAAAGAGTTGGAGT
TCTATCTTAGGAAAATCAAAGCCCGGAAAGGCAAATAAATCCTCGTTTTGTCTTCACCCG
TGTAATAAAGGTGTTTATTGTTCTGTTTCCCCATTTGTGTTGCCTGAATATTTGACTATT
TGCTTTATTTCCTTGCCCTGCAAAACTGATCTGGGTGGGTGGCTGCAACCCATTGCTTTA
CCTCTACCTCCTACTGTCTTGATCCAGACTCACCACACTGTAAAGTCCCTGTTCTCAACT
CCATGTCCCTGAAGGCTAGATTTATAATGTGGGCTGTGTCTATAGTGGGAACATTTCTCC
ACGTTTTGGTGGGGATAGGGATGTGGCAGAGGCTATGAGAGGGGGTATCCCAACCTTGGG
GTTCAACAATGTTGTGCTGACTGAGTCATGATTAGAATCTCAGGCTATATTGCTTCTAAA
AAGTTGTAAGGATCCTGCACCCACTGTAAGATTAACAGTGATTTCTGCCTTGCTTGGTCT
CCAAGGGTCACTTTGACTTAAACTTGTCCTGTCAAATGCTTACCTTTAGTCTTGACCTGC
TTGACATCTGCACTTGGATTTTTTTTTGAGATCTCCGTCACCCAGGATGGAGTGCAGTGG
CATGATCTTGGTTCACTGCAGCCTTGACATTGGGGCTCAGGTGATACTGCCTCAGCCTCC
CAAGTAGCTGAGATGATAGGCGCTACACCTTTTTTTTTTTTTTTTTGAGACGGAGTTTGA
CTCTTGTTGCCCAGCCTGGAGTGCAATGGCACGATCTTAGCTTACCACAACCTCCGCCTC
CTGGGTTCAAGCGATTGTTTTGCCGCAGCCTCCCAAGCAGCTGGGGTTATAGGCATACGC
CACCACGCCCAGCTAATTTTGTATTTTTAGTAGAGACGGGTTTCAGGCTGGTGCTGAACT
CCTGACCTCAGATGATCTGCCTGCCTCAGACTCCCAAAGTGCTGGGATTGCAGGCGTGAG
CCACCATGCCTGGCCTATACCCATTTTTTTGAATTGTTTTTTTTGGTAGAGACAGGGTCT
CACTTAATTGCCCAGGTCTTGAAATCTTGGGCTCAAGCAATCTTCCCACCTTTGTCTCCC
AAAGCACTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1454..1560, 2092..2191, 2992..3167, 3377..3506, 3948..4109
1020..1023, 1454..1560, 2092..2191, 2992..3167, 3377..3506, 3948..4054
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved