Macaca_mulatta Locus ENSMMUG00000012846
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000012846
Macaca_mulatta
ENSMMUG00000012846
4
SNORA29, SNORA20
4917..5056, 10308..10439
12991
TGGGCGAAGGGGGCCAAGACTAATTACCAGGGTTCCTGCAAACGGAGAACCCCCAGAAC
CGCGACCGAAGCGCCATCGCTGAGACGATCTCGGAAAAGCCTTGCCTCTTTTTCCTCACG
CACGACTCACTCGCTCGCCTGCCGCAATCATACGAAGTCAGAGCCTTTGGTTGCCGTAGA
TCCCCAAACTCTCCACGCCAGACGCCCCCGACCCGGAAGTAGAAAGTCCTCCGCCACTGA
GTGGCCAGGAGGAGGCTCTGTTATCCGGCAACGCCAATCACCGCTCACGTGGAGGGGCAC
GCAGGCCCTGGAACCCACCAATCACCTCGTGGCTACGCCCACGACCACGCTTTTTGCTGA
AGTCCAGGGTCAAAAGCACCCACAACTTCACCTAACCGTATTTGAGTTGTCTACTAAGAG
ATCTTGGGCGGTCATTGACTGGTCCATACACACCCCTACTGCGCACCGCGTAGAAATGAG
GCAGGGCACGGTGCAGTTTTCGCTTTAAAAAGGGTAGTTGTCTTCCTCGAACCAAAAATT
TTCCCGTATGGCCCGCTGGAAAAACTGCCCCGTCCCACCCAGGTTCGCGCCCCTAAACTT
ATACTCCTGAGGCCTGGAGCAAAGCCGGCCGATTTGCCTTACGCTCCCCGAGCAGGGACG
AGGAAAAGACATTAAAGCTAAAACGCAAGACTCGCTCAGAACCTCAACTCTACCTTGGAG
AAGGGCCCGCCCCTCCAGTTACACCCCAGCTCCAAGCTCCACCCGCCTACAACCTTTCTA
GAAGGCACTAGAATGGCCCACTGCGTCTGCGCAAGGTTGTTTGCACCGAAGGTTCCGCCT
CTTTCCAGCGGTCCAAGATCCGACTTCCGTTCTCCGCTTTCGCGCCCTTCCCATCGGCTA
TCTAATTGGATAAAAATGCCGATCCCGCCCCTTCCCTAGAGCCTCACTTCCGGCACGCTC
CCGTTTCTCTTCCTGTTGCCCCCGCCTCTTTTTCCTTCCCGCCGTGCCCCGCGGCCGGGC
CGGGGCAGCCGGGAAGCGGGTAGGGCGGTGTTACCCAGCAGCTCCTGGGGCATCGCTCGG
GTACCCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCAGTCAGCCGAGGGACCGCGATA
CTGGTCGCCCGCGTTGTGAGCAGAATTCAACGTGTATCGCTGCCGCGAAGATGGAGGGGC
CTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAGCGATCCGCTCCCAGAACGGTAAGG
GAGGGCCGGGCCTGGGTCGGGCTGGCGGGCTGGGAGGGCCGAGTCCCATCGCGACCGGAC
CCCGGCTGACCGCTTCGTGCCTCTTCTCCTTTACCTCTGCAGAAAGGGCCTCGAGGCCCC
GCAGCCGGACCCGGCCCACCCGCCGTTCTCTGGGGCAGGGCGCTGTCGACCCCTCTCCCC
ACAGCGGGGAGGAGCCCCGGAGCGCGCAGCAGGGTTTTGAGACCGGCACCGCGTGGATGT
GGTGTCCGGGGCGGCGCTGGAAACGCGCCCCTCCGCGGGAAAGCGGGCCTCCCGGACTTG
CACGTGCGGGCCACGCCTCGCATCTTTTGTTTCAGGGCGGCCCCCTGAGCGTCCATGTTA
AACGCCGGGTTTCGTTTCAGGACCATTTACCAGAAAAAGTAGGTTCATCCGCGCCCCTGC
GGATGAGCCCGGTGCCCTTTCCGCCCGTAGCTGCAGTCGGGGTCGGGCGCCCGGCGTCCG
GCTCTCTCTCGGTTGATAGCATCTTAAAGTAGAGTTAGCACAGGAAACGCCACTGGAGTG
CAGTTGACCCCAGGAGACGGCAGCGCCAACTTAGCAGAGCGTTTGCTGTCGGGCCTTTGT
ATACCTACAGAGCGCACTGTTTTTTGATAGATTCGTAATTTTTTTTCGTAAACAAATCTG
AAAGTACCTTCCCCGTTGGCTACCGATTTCTCTCCTCACAGATAAAAAGAGTTCTAATGA
GCAAAAAACTTGCAGGATCTGAAGGAAAAGGCATAGCTGTACGAAGTGGCAGAACATGAA
ATTGTGGTTATTACTTTTTTTCTCCCGCCATCAGATTCCACCCCCTCATCAAAGCTGTGC
CAAATAGGCTCGCTTTATTTAGGGACAGGGTCCCACTTGTCGCCCAGACGGGAGTGCCAG
CATAGCTCACTGCAGTCTCCAAGCACAGGCCCGCGCCACCACATCGGCTTTGTTTTTATT
TTTTGTAGAAATGGGTTTCGCTGTGTTGCCCAAGGGGGTCTCGAACTCCTGTCATCAAGC
TATCCTCCTGCCTCAGCATCTCAGTGTTGGGATTACAGTTGTGAGCCACAGTGTCCGCCC
CATTTAGGTTCCTAGTAGGTGGTTTTTAAATAACGCAGATTTGTACATTTGGGAAATACA
GGGGCTGTTGGATGTCATTTACCTTTAGGCTGAAATTACTGTCTTTCAGAGTTGTGGATT
CTTATTTCTTTTTTATTTGTGTTTTTAATTGTCTACAGTTATGGCTGCAGCTTCGATTGC
CAATATTGTAAAAAGTTCTCTTGGTCCTGTTGGCTTGGATAAAATGCTGGTGGATGATAT
CGGTGTAAGTACACGTTAACTGTTGTGTTAGTTGCCTTAAAGTAAAACTATTTTCAGTGT
TTTGCTGTGTTCATTCTTTGATTTTATCAGAATCCAGGTACTGGAAGGTGATATTAAAGG
TGAATGTGTATTATAATGGGGCTGTGTTGATTTCTATGAGTGGTTCATATTTTTTCCTGC
TAATTTCTTAGGATGTGACCATTACTAACGATGGTGCAACCATCCTCAAGTTACTGGAAG
TTGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTG
GAGATGGAACTACATCAGTGGTAGGTAGACTGGCTAAAGAATGATCATTTTTCTAAAAAC
AACCGACTTTCAGAAAGTTGAAGCCATAAGTGGGTCATTTGTGCTGGGTCAGAAATAAGT
TACATATTCTGAATGCCCAGATGATTGAGCAAAGAGAAAAAACAAAAGAAGTTACACATT
TAAGAGGGAAAATAAGCTTCTTAGGTACAGATTCAGAAACACAATTTGTAAGTTGGTAGT
TATAGCTTGTTTGTACAGTTTAAGTAGGAAAGAATTTGAGTTCATTTAACATAGCCCCAT
TGTTTTAAATGTTGGTATTCACAAGTTTTGAGGGCTTATTTTTCCCTTTATGGCAGTGTT
CAGACATCACACAGATTTTTTTATGGTCTCTCAAAAAATCTTGTTTCCTCCCGCATCACC
CCTTGAGACTTGGAAAGCTCTAAAGTATAATTATTTAGAGAACAAAATGTTACCAGTTTG
GGGGAGAAACAATGTTTTTGTGTTATTTTTTTAAGAGACCATGTGTAGCACAGGCTGAAG
TGCTGCAGTGCTGTCATATCTCACTGCAGCCTGGAACACCTGGGCTCAAGTAATCCTCCC
GCCTTAGCCTCCCAGAGTGCTTGGGATTGCCGGCATATGCCACCACAACCAAATAATTAA
AAATCTTTTTTTTTTCTTTTCTTTTTTTTCGGTAGAGACAGGGTCTCACTATGTTGCCCA
GGCTGGTCTTGAGCTCCTGGCCTCACGTGATCCTCCCGGCCTCATGTGATCCTCCCTTCT
CAGCCTCTGTAGTGCTGGGATTACAAGCATGAGCTGCTGCACTAAGCCTGTTTTATTTTT
TAAATCCTGACAGGTAATCTCAGGAATTCAAAATAGGAGTGTGAGAAATTAATAAATACA
TCATGATAGGACAGTGTGATCTTTTCGAGTCAGTAAACGTGATATACAGTATAAACTTCA
TAGATCATCCAGCATGCTGGTATAGTAGAAACACTTGTTTGGTGAGAAAGATGTTAATTC
TGGAGAAACGAGTAAGTTTGTGGGGAATATGTATTTCTAGATTAAAGTTCAGCCATGAAA
GAATGGAATGTACTCCTAAAATATGAATATGATCTTTGTCTAACTTATGATAATGTGACT
TAACAAGTGTAGTTTTCTTCCCATAAGAAGCTGACAAGATTTTAAGTCTTCTTAGTTTAA
AAGTATTTGTTACTGTTTCATATCAACTTATAAGAACTGTTTTTAATAATATAAAAGCCT
AATATAGGTCGTATGAATAGTCACACGGTTTAGCTTCTATTGAGCACTCCCTCTAAAGGT
AATAGGTGTGTTGTCTTTCACGATTGTATTGGGTGTACTAGTTTCTTAGAATGTTTTTCT
GGCTCCTACCCAGTTTTGGCCATTTGCATTTATAATACAGTAAGACCTCACTCCGCAATG
GATTCGTGGAAACTGACTTTAAGAGGAAAAACGATGTATAAAAAAATAAATTTTCCTCCC
CCCATCAGCGTTAACAATAAACAACTGTATTTGAGAAATTGCTGTCCGTTGTTTTGCTTA
AAGTGGCAGTTTCCAAGAATTTATGAGTAACATTGAGGACTTCAAGTGTTTTGTAGCGTT
CTTCTCCCTTCACCCCCCAGGTTTCTAATAACCAGTTAATTCATTTCACCACCACCATTT
TGGCTAATAGATGGCCATTTTAGTGTCATTTCATGTGTATTGCACATGTTGAATATCTGG
CATACTCAGATCAGTGAATGTTTTCTCAACAGGTTATTATTGCCGCAGAACTCCTAAAAA
ATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGAC
TTGCTTGCAAGTAAGATTGTTTGCATAGAGAGAAAATTTTTTTTGATGTAATAGTTGTAA
AGTGTGTTGTCTTAATGTTTTGATTAATAACTAAATTTTAATTTGAAAACATTCTATTTA
AATGTTTTAGCATTTAAGTAGTAATATTTGAAGTTAAAAACTTGGACCGGTATCTTTTTT
CCCATTTGACTACCACATTTTCTCCTAATCATAGATTTTAGTGGTTATGCTTATGGGATA
GATTAAACTTGCCATGATCTGAAGAGGGAGGGTTTTTTCATGTCCTCCTCCTATATGAAA
TGGCTGAACAGATATTACTTACGACATTTTGGCTCTGTGTTAAGCATGATGATTGCAAAG
AGTTTGAGTAGTGACTTTGTAAACGTTTTTCTCCCCCATACTTTTAAACAGGGAAGCAGT
GCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGAT
TAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATGTATCCTTGTGGTTGTCA
GATAAAATTTAGGCTTTTTAAAACATAAGACTTTGAGATGGGCATGGTGGTGTGTGCCTG
TAGTCCCAGCTACTATGGAGGCTGAGGCAGGAGGATTAATTGAACCCAGGAGTTTCAGTC
CAATGTGGGCAACATAGCAAGACCCTGTCTCGGGAGTGGGGGTGTGTGCATAAGCGCGCG
CCTGTAGTAGCAGCAGCAATCAATTTTGTGCAGTAAAATTTTAAATACCAATTTTATGCA
AATTGATATCAATAGGGAGGAGTAATGCTGTATTGAAATTGCCTGTTGCTTTCCCTGCTT
TTTTAGGGTGAAAAGGTAATGAAAAGCATGTCTAAAAGTGATAAGAATTGCAGATAGTGA
TAATGTAATATTTTGGTGACGTAATGCTTGCTTCTTTAATAGGTTAGGTTACTAAAAGGA
AGTCCTTTCAAATTATCCTTGATTTTTCACTTGTGTACCCTTTGTCCATTCCAAGCCTGT
TACCGTCCTTAACTTTTGGCTTAGAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGC
TGTACTTGCTATTAAATACACAGACACAAGAGGCCAGCCACGCTATCCAGTCAATTCTGT
TAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGC
ACTCAACTGTGTGGTGGGATCCCAGGGTAAGGTTTGGGATTTGGTTTATACAATGAGATT
GCTACAGATTAAAACTAGCTTTTTTTTTTCTTCAGCGGGACGCAGTGCTTCGTGCCTGTA
ATCCCAGCACTTTGGGAGGCCGAGGCAGGTGGATCATGAGGTCGGGAGTTTGAGACCAGC
CTGTCCGATGCGGTGAAGCCCCATCTCTAGTAAAAAATACAAAAATCAGCTAGGCATAGT
GGCGCGTGTCTGTAGTCCCAGCTACTCCAGAGACTGAGGCAGGAAAATCACTTGAACCTG
GGAGGCAGAGATTGCAGTGAGCCAAGATCACACCACTGCACTCTAGCCTGGGCCACAGAG
TGAGACTCCGTCTCAAAAAAAAAACTAACTTGTGGATTATGTGCAGTACATCTTTTTGTA
ATTTAAAGCACATACAACATGTTGGAATGTGAATTAAAAGAAATTACGTGCATGTAATGC
CATAAAGTTTTTCTAAGAGAAAATGTAATGAATTACAGTCTAAATTTGTGTATTTACATA
CAATCAATTATGGGTACTCTTTATTATGCTTTTAAGGATAGACGTATTAATCTTATGTTC
TATTGTAGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTTAGCCT
GCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGA
CCAAATTAGACAGAGGTATGTTGAGAGATTATTTTTGGGCTTTTAAGTGTGAGTGTCTTG
GAGGACTTTAACATTTTTAGCCAAGTCAAACTATTTTACTTAAACTTCCAGAAAAATTAG
CCTGGTGGTGTTTTTAGAGGGATTTGGGGTTATACAACCTATATGAAAATTGTCTTTTTG
TGAAATTTTGATTGTATGAGTCTGTTAATATTAAAGATATAAAAGACAGGAATCTAATTT
CCTCAGCAGTACAGAACTCAGCAGTGTGGTATTGACTGTAGCCTACTGTTTGCTAGATAC
TGGAGGTACAGGTGATATTAGTGGTTGAAGAGCTAATGGTGGAGGTAGTGTGACCACTGC
TATAGATTTGACTGCCTAATAGTCACTTAAAACAATAAATGGTTTAGGCTGGGCACAGTG
GCTCATGCCTGTAATCGCAACACTTTGAGAGGCTGAGGTGGTAAGAATCTGAAGCCCAGG
AGGTCGAGGCTGCAGTGAGCTGTGATTGGACCACTGCACTCCATCCTGGGTGACAGCGAG
AACCTGTCTAAAAAAACAAACAAAACCACAATGAATAGTTTAAACAGAAGTTAAACCAAA
CCTACAAGAAAGCTTTGCCGAGGGTAAGAAATGTGCTCTCATCTTTTAAATCAATCTGCA
TGCGTATTCTTTTTTCCTTCCTTCCTGATACAACAAAGTGTCCTTTCTTCCATCAAAGCC
AGTCGCTCTACAGTAAGTGTTCCAGAATCTGTTTCCTTCTGCTCTAGAGCCTTGTCTTTG
ATTCTTCTTTCATACCTACTAATTATGCTCTTTCCTGGAATCTTCATGTGGCTCTTTTGT
CCCTTCAGGCTTCTTTGTACATCCTCCTGCTGTAGGTACTCCCTATCCTACATCCTTACA
GCCAGATGTCATGAGTGATTTACTACACAAAACTTTTCTGGTGCTTTTCTTCTCATCCCT
TTTCAGCCCTGTTCTCCATTTGAGGGACTGCATGTTAAGGTCTCTAGTGTGAAATTCGGA
AGACATTTTCAGCCTTCCTCTTACTTGACCTTTAGCAACCCTTTGATTACGTCCTTCTTG
AAATGCTTTGTGATACTGCTTTGTCTGGGCCACCATCTCACAATATTCTCCAGAATAGCC
CCTTGTTCCCATGACTTCATGTATTATCTCTCTATGCCAGAGACTGTTTAAGCTGTTTCT
CTGAGCTCCAAAGTCACACACCTCTATCTAATAGAATGCTTTTCAAGCATCTCAAAGTAA
ACATGTCTCTGAACTTGTGATAATACCGCAAATCTGCTCTTGACCATTTTAGTGATGGGG
ACTTCTCCACACAGGCAGAAAACTAGGAAATGTCCTTAACTCCTCCTTTTTACCAACACC
TTTTCTCCTAATCTGTCACTAACACCACTTGATTTCTACCTCCAAATTAAATTTGCCTAC
ATTTCATTTTCTTGCCTAGACTGTTGTAGAAACACACCCAAGCTAGTCTCTTAGAGAAAC
TTTCTTTCTTCTGCAATCTAAATTATATTCTTTTGTAACTTCCTGTATTTTATCTTCCTG
GGGCTTACTACAGTTTTTACTGTGAGTTTATACAACTCATGAATTGTAAGCTCTAATGGT
AGAGACAGAATGATTCCATTGGCATCGTAGCCCCATCCTTAGTACAGTGTATAGCACACA
GTACTTGTTCAGTAGATAAGCTGCCTTTGAGGTTGATCTGTAATTCATTTTACTTTAAAA
ATTATTCGAATGATCTATTCACATGGCTTCACTCATATTGTCTCTTCAAATCTGTATCTC
CCATAGTTTGTGGTTTCCATGATGTTAAGTGACTACCTTCTGGGAGCTTCATCTGAGTAA
CAACAGAGACTTCAAACTTAATCTTGTCCCAAACTGAACTCTGATTTCCCATCCTGCCCC
CCAAACTGTTGCTATTTATTTTACTCCAGGAGTCACCCAAGCCATTAAATTTGACTTCTG
TTTAGGTTGTCTGTCAGCTTATATCTGATGTTACTATCTCCTTGTCTTAAGCCATTCAGT
GCAATTTCCACATTGATACCAGGGAATCCTTTTGAAAACGCAGATAACATTATACTAGTC
TTGCTTAAAAATGTTAACCTTCTTAGTATCTAGACTGTTTGGTGTAACCTACAAGGTTTT
TCACTTTTCTGGTTCTGTCTTCTTTTGCGCTTCCAACTCTGGACTCCTGGTGTTTTTTTT
TGTTTGTTTTTGTTTTTTTGAGAAGGAGTTTTGCGCTTGTTGCCCAGGCTGGAGTATAGT
GGCACGATCTCAGCTCACTGCGACCTCCGCCTCCTGGGTTTAAGTGATTATCCTGCCTCA
GTCTCCTGAGTATCTGGGATTACAGGGGCCCACCACCAGGCCCAACTAATTTTTTGTATT
TTTAGTAGAGTGTTTAATCGTGTTGGCCAGGCTAGTCTCGAACTCCTGACCTCAGGTGAT
CTGCCCACTTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACTGCACTCGGCCT
GGACTCCTCTTGACTTCATTATCTGCCTCCTAGGCTAAATTTATGTCTTTTATATGCTTG
TAGTCTCTGCATACCACTTTAGTGACGCTTGCCCTGGAGTGTGATTGGTAATCCCTCTCC
CCACTGGATCCTTGAAGGCAGGCAGGACCTATGTTCCCTGTTTTACCATAGTTCTCGATT
AGTAATTCAAATTCAGGTTGGGGAGAGCTAAGTGGTAATTTTTAATTCCTTCTAATATTC
CATGAATTGGACTAATGTAAATTCTGGTCAGAGATAACAAAGGTTAATACAATTTAGTCT
ATGATTATCTTGTGATAAATACTTAATGGAAGTTAAAGCTAAATTATTTTTAAAAATCAC
AGAAGGTAACTCTGGGTTACAAAAATACTTTGCAGAGAATCAGATATCACCAAGGAGAGA
ATTCAGAAGATCCTGGCGACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGAT
ATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGG
GACCTTAAACGCATTGCGAAAGCTTCTGGAGGTATGTCTTGTGCTGGCTGTCACGTAAAA
GACTTTCATTATACCTGACCCCATCAAAGGTCTTTTTACATTGGAATATTGGTAAGAAAC
AGCTTCAAAAACGTTTATATCCTCTTAATGCTTTGTGCTGCCAACACATTTATAGAGCCA
TTTTTCATGTAACTGGAGAAATTCATTAAGTTTGTTGGAAATTCTGAATTTGTTCACTTC
AAAAATGATGTAGTTCTATCTTAGGATAAAAGAAGTTAGTGTGTGCTGCCTAACTAAATT
CTAAACTTGTAACATAGCACTTCTATCACAAATGCTACTGAGTCTAAAGGATATTAAAAT
CACGAAAGAGCGATACTTACAGATCCCTTGTAACTCTTAATAGCAACTATTCTGTCAACC
CTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAA
GTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAAGTAAGAGCTACTT
TCTAAAATTGTAAAGTTATACAGATTTTGTTAAGTAAAAGTAGGTTTTCTTCCCATTTAT
TTGCTGCTTATAGTCTCACAGTGATATGAGCAGTTATACGCGTGGGATAAAATAACATTG
GGTCACTGTGAATTGAGATGAAGTAACCATTTTCATCTCTTCTGCATAGACTAGACATTG
TTTCTGTATAGTGTATCTAAATATCTTGTGTAGGCAGGACTTAAGGGCACTTTATGTAGA
CTTATTAAAATGCCATTTTTTGGAGAAATTGATGGTGTTGGAAAAAAAAAAACATTTAAA
AAATGCTATTACAAGAATTTCACTTTTTTTTTTTGAACAGCACTAAGGCTCGTACATCTG
CATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCGTTAC
ATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCCGTGGTTCCCGGTGGAG
GTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGTAAGAA
CAGTTATTCCTTGTCTTAGAGGCCCGAGAGCAGTAGCTGTGGGCTTTAATTTTTTTTCCC
TTTTGTGAAGTCACCTAACTGTCCTTTTTTCCTAGGGGTCTCGGGAACAGCTTGCTATTG
CAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGG
ACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCTCAGGTTAACCCAG
AACGTAAAAATCTAAAATGGTAAGCATACAATTTCCCTCTTTTTAGACATCTTCTTAGCC
CTTTGTTAACCTCTGCAAAACAGTTTCCATTAAAAAGGATAGTAGTCAGTTACATGTCAG
CAAACATAAATAACAGACTTGTCAACTACTTAACATGAAAAACTTCACAGCAAGCATTTG
TTGTTAGTCACTGTAATTCAAGGGATAATGACTAATTATTAGCACTGGTATGCCTTAGTT
AACAACTCTGATTGCTAATCTCTCCCTGCTGCTTTGGGTAGAAAGACAACCTACAAGATC
TCTAGTCTGACTTAAAAATCAAGCTTAATACTTGAATGAAATGCTGGAGTTAATGGGTCA
CCTAATTAAGTTGTAAGCGGCCATTTTAATAGTTCTTTCTTAATTGCAGGATTGGTCTTG
ATTTGAGCAATGGTAAACCTCGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAG
TTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATTACCATTCTTCGAATTGATG
ATCTTATTAAATTACATCCAGAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTG
TTCACTCTGGAGCCCTTAATGATTGATCTGATGTCTCTTTTATTTATAACAATGTTAAAT
GGAATTGTCTTGTACCTTGACTTAAGTATTACACATTAAAGTACAACAAGCTGTAAACTT
GGGTTTTTGTGATACAGGAAATGGTTTCCATCTGTGTTTTGGTCCTCTGATTTCACATAT
AACAACCTAGTACTTTATTAGTTTAAAAAGAAATTGAGGTTGTTCAAAGTTTAAGCAATT
CATCCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCACAGGGCCGCAACA
CCACGAATTCCGCCCGTTCTCTCCAGTGTGTGTAACAGGGTCACAAGAATTCGACAGCCA
GATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTCAATGTTGACCTAAGGGGAA
GAAAAGATTTAGATTGTTTATTCTTCTGTGGGCACAGTTTAAAATCCTAAACTTGTCTTT
TTTCTCTTAATGTATCAGCATGCTACCCTTTCAAACTCAAATTTTCATTTTAACTGTTTA
GGAATAAATTTACACCTTTGTGAAAATTCATCCCTGCCTATGTTACCTTATTCTTTTTAT
GCCAAGTAAGCTTTTTTTTTTTTTTTTTAAACCATGGGAAGTAACAAAATACGTGAACTC
AGTCCTAGTAACTAGTATTTCTTTATTACCCACGTGGCCAACACCTGGAAGATGGTATCT
TAAAATAGCATTGTGAAATTCACTGGTAAGCACTCAGGGTTACTTGTGCATCTTTACCTT
CTGTGGGTTTAATCCAAGTTCTTTAACTATTGCAACAGAGAGGGCTGCAAAGGCTTCATT
GATTTCAAATACATCAACATCCTCCAGTGACCAACCTGCTTTTGTAACCTAGAAGACAGA
TTCATAGAAAAGATGTCTAAACTTGGGTGGAAAGGCCAAAACATCCTTTGTCAACATAAA
TATGAAATATGCTGCATGATACTGATCTCTTAATTGCTACTTTCGTTTGTTCTTAGGTTA
ATACAGTGACATTCTCACACATTTTTGCCTTAGTGACACCCATTCCATCCAAAAGGTTAA
GGATGTGATCTAAAAGATCCCTTAGAAATTCTAAATTGTCTTAAATTTTGAACCAGTAGC
ATCTGTTATATGTATTTAAGGGTAATGTAACAGAATCAGTTCCCCTAAAAAGCATATGAT
CTAAATGCTTTCAGTGGCTGGGGGTAGTGGCTCACACCTGAAATCTCAACACTTGGGGAG
CCTAAGGCCAGAGGATCACTTGAACTGAGAAGTTCAAAACTAGCCTGGGCAACATAGTGA
GACCTTGTCTCTACAAAATTAAGAAGTTAGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1253, 2498..2583, 2771..2899, 4652..4749, 5151..5261, 5784..5965, 6548..6674, 9575..9750, 10123..10246, 10600..10792, 10895..11058, 11449..11991
1190..1253, 2498..2583, 2771..2899, 4652..4749, 5151..5261, 5784..5965, 6548..6674, 9575..9750, 10123..10246, 10600..10792, 10895..11058, 11449..11662
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved