Macaca_mulatta Locus Q3YAQ2_MACMU
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Q3YAQ2_MACMU
Macaca_mulatta
Q3YAQ2_MACMU
19
SNORD35
2268..2355
5203
GGAGAATCGCTTGAATCCTGGAGGCGGAGGTTGCAGTGAGCTCATATCGCGCCACTGCA
CCCCATCCTGGGTAACAGGGCAAGACTCCATTTCAAGAAAAAAAAAATTAGGTCCTCAGT
CGTAAAAGTCACGTTTCGAGTGCCAGTCACTACCGTATCCACCAGCGCAGATACAGAAAA
TTTCCATCACATAAAGTTCTACTAGACGATCCTGTTATCGACAGAAAACCAGCAGAAGGA
TCGCTCCACCGCAACCCCTGGCACCAATTAAATCACCATCTGCGGATGAAATGAGAAAAG
TAGTTTGCTTTCTCTCTTTTTTTTTTTTTTTTCCTTTTTTTTGAGTCGGGCTCGCTCCGT
CGCCCAGGCTGGAATGCAGTGGCGCAATCATAGCTCACTGCAGCCATGACCTCCCCGGCT
CAAGCGCTCCTCCTGCCTCGACCTCCCAAAGTGTTGTGATTACAGGCGCGGCCACTGCAC
TCGGCGAGAGTAACTTTCACTGCACTTCTGAAAGCTCGTGGGCAGCTCCTGCCCCTAACA
AAGATGGCGACACCGCCACACATGCTCCTAGCACTCTCCGGCGGCCTGCCCTTCAAAAAG
ACGGCCGCCGCCTCATCCAGTTTGAAGGCCGAACGAACACAGCCACGCTGTATCCAAATC
CCACGGGAGCCTACGCCGCGCAGAAACAGGACGGACTCCGTACGACTCTCGCGATAATAC
GGGCGGGCTGAAGGCTGCTCACATCTTACCAGCCTGAATAATCGCGCCCGGCGCCGTGGG
ACCTAAGACTCTCGCGAGACAGTATCCACCACTTCCCGCCCGTCAGTCCTTCACGGTCCC
CGAACCGCCTGCTGGTTGAAGTGCAGCCTGTCAATCAGAGTCGCGCTCGAGGCCCCGCCC
AAGGCCGTGTACGCCGCTCCTTACGTAAGTTCCTCTCCAGCCCCTGCGTAGTCGATAAGG
AAGCCCGGACGCCACTGCCGCTTTCTTTTTTCAGGCCGGCCGGGAAGATGGCGGACATTC
AGGTGTGGGCTCGAGGCTTGGTGTCAGGCTGCAGGGTCCGCCCTGGCTTCAGGGGCGTAT
CCGGGAGGGCAGAGCCGGGCGCCCAAGTTCGGGGGTTAATTCCGGGCGTCCGTGATTATT
TTCCAGAGATTAGCTGGGGCGGAGGGCGCATGCTTTTGCCTGTTTCTAGACGAGTGCTTC
CTAATTCCTGGGGGCTCCGGGCGTTAATGGAGGCTCAAGCGTTTTAGGACTTAACCTTCT
TAAAAACCAAGTTTAAGAAGGTTTTCTTGGAGTTTTCCGGTCTTAAGGGTTAATTCTATG
GAAAAGGACTCCTAAGGGCGAATCCAAGGAGCCTGCCGTTTGGTATTTAATTCTGAGTTT
TTATGTACCACATAAGGAGTGAATCCTGGGTGGGCGACCTTGGGTCTTGGAGAGTGATCC
TCGCTGAAAGATGTCCAGGGTGTGAGAGGGGTGGTCCTGGTTTAGAGGATGAATTTTGCA
AGCCCTGGGAGGCCTTCTGGAGTATATAAATTGAAATAACCTCGGGCTTAGATCTGAGTA
TGAATTACAGGTAAGGTCGGGGTGGTCGTGTCTTAGAGGGTGATTCTGGGGCACCAGGCC
TTGGAGGCCAGCGCTTTGCAAGTAAATGTAGAGAATGGGGTCTGGGAGGTTCTGGGAAGG
TCTCTAGGGCTGGTTGCTGCCGGCTGCAAACTTAGCAGCTCATCAGTTTTCTCATACCTG
TAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCTTTCAAAACAAGAAGAGGGTCCTG
CTGGGAGAAACTGGCAAGGAGAAGCTCCCGCGGTACTACAAGAACATCGGTCTGGGCTTC
AAGACACCCAAAGAGGTGCGGGGAACCTCAGAAGAAAGAAGGGGACCGTGGCGTCCCTGC
ACGTGTGCCCACATCGAGTTGCGTCTGAGTGGCCGGTCCCGGGGCTGATGGGAATTGTAG
TTCGCTTCCCTGGGGCCACGCCCCCGGCTCTTTTCAGGAACCGCCTGCCCAAGGCTCACT
CTTTTCTCTTTCCTATCCGTTCAGGCTATTGAGGGCACTTACATTGACAAGAAATGCCCC
TTCACTGGTAATGTCTCCATTCGAGGGCGGATCCTCTCTGGTAAGTGCGGGAGTTCTTGG
TGTCTGGGGCCTGAAATACTGAAAGAAGGGGCTTGGGGCCCAGACTCCTGGGTCCTGGGT
GAGAGAGGTGGTTGGGAATGCAAACTTGTGGGTACAGGCAGGGGCATTGGCAGATGATGT
CGGTTTTCACGATGGTCTTCAGATGCCCACGTGGGCACTGCTGAGAAAGCCACTTGGTTA
AAACTGATGCCGGAAACAGGGCTTCTTGGGATTCCTGCTCAGCTGCTGCTGACTCCCAGC
ATGCCCCAGGTTACCCATGGCCCTCTTTCCCATGGGACTTGACCTAGGATCTGCCCCTGC
TCCTAGGTGTGGTGACGAAGATGAAGATGCAGAGGACCATTGTCATCCGCCGAGACTACC
TCCACTACATCCGCAAGTACAACCGCTTCGAGAAGCGCCACAAGAACATGTCTGTGCACC
TGTCCCCCTGCTTCAGGTGAGCACGGTGGCCCATCAGGTTGCTCAGGCCAATTTAAGGCC
AACTGAGGGAGTGGGTGACTGAGGTGGCATCTCTGGGAAGCCCCAGAGTCTCAGGATTTC
TATATTATATGTTCTTCAGAATCAAAGTGTTCCACAGGTTGAATATCTCTGTCTGAAACG
CTTGGGACCAGATTTTGGAATGTTCTCATATGCATAATGAGATGTTTTGGGAATGTGACA
TATGACGTAGGTCTAAACACGAAGCTCATTTGTTTCATGTCCATCTTACTCACACAGCCT
GAAAGTAATCTTACGCAGTACATTTTATAATTCTGTGTGTGAAACAAAGTTTGCATACAT
TGAACCATGGGAAAGCAAAGGTGTCATGCTGGTACGCAAAAAATGTCTGATTTTAGCTGG
GCACCGGGCTCAAGCCAGTCATCCTAGCACTGTAGGAGGCTGAGGCAAGAGGATCCCTTG
AGCCCAGGAGTTTGAGACCAGCCTGGGCACATGGCAAAACCCACTACAGAAAATACAAAA
GTTTGCCAGGTGTGGTAGCATGTGCTGTAGTCCTAGGTCTTCAGGAGGCTGGGGTGGGAG
GATTGCTTGAGCCCAGAAACTGGAGGCTGCAGTGAGCCGAGATGGCACCACTACTCTCCA
GCCTGGGCAACAGAGTAAGACCCTGTCTCTCCCAGACACACACACAAAATTCAGATTTTG
CAGCATTTCAGAATTTTTGGATTAGGGGTGCTGAACCTGTAATAGACAGGTGCCTTGGAA
CCAAAAGGTTACACCAGATGGGAACCTCAGAAATGTTGGAATTAAACGTTTGTTCATTCC
CTCAGCGTGTTTTATTTAGAGCTTATCACGTGCCAAGTTTGGTGTGAGATGCTGGGGGTT
CAGTGGTGAGCCAGGGACAAAGTCCTGCTTCCTCAGAGGGCACCTTCAGGCAGGGTGGGT
GCCAGATGTCAGCCAGGTACAATGAGGGTGGGGATGTGGGCAGCTGATAATGGTGGCCCT
CTGGGCGGGAGGATCTTGGGAGCAAGGTGAGAAGTCCTGTGGGCAGGGATGAGGGTGGCC
CGAACTGATGCTGAGCGGTAAGGGGCCTGTGGTCGTGGGTGCTACAGGATCCCCCTGCTG
CTCTGCTGGAGTGGGGTGGTGAGGAGGCCACTGACAACCTGGGGGCCTCCAGTTTGTGAA
ATGGAGCTCGTCCACCCCAGCAGTCCTTAGAAGGGTGGTCGCCTGCTCTGTGTACAGCGT
TGAGCTTGGTACTTGGCACAAAGTTTGTACCAAAGAATGAGAGGGAGGTTGAATTGGCAA
ATAGATCTCGGTTAGGGTTTGGTGGAGCCAAAGCAGAGAGCCTTCAGCCTGGCGAAGGGG
AGGGAGGGCCTCCTGGGGTCCGCCGGGGTGGCCCCTCCTGAGGACATGGCCTTACCTGCC
TCCACAGGGACGTCCAGATCGGTGACATCGTCACAGTGGGTGAGTGTCGGCCCCTGAGCA
AGACAGTGCGCTTCAACGTGCTCAAGGTCACCAAGGCTGCCGGCACCAAGAAGCAGTTCC
AGAAGTTCTGAGGCTGGACATCGGCCCGCTCCCCACAATGAAATAAAGTTATTTTCTCAT
TCCCAGGCCAGACTTGGGATCTCTGTGCCTTTACCAGAGCACTAGGGGGATGGGGGTGTC
CCTCGGGGAATTGAGCAAGGCTGCTGTCAGGCCTCCTGCCCGTGTCTGTGGGTGAGGACA
GTGGAGCCTGAGATACCTGTCTTCCCCTGAGTCTCCTTTTTTGGTCCTTGTCACCTTTTC
GGTGTCTGAATAAGGCTGATTACCTGGTGTGCTGTCCTCCCGCGTCACCTTTTTGGTGTC
TGAATAAGGCTGATTACCTGGTGTGCTGTCCTCCCGCCCCCTCCGGTCTCTGGGGAGGAA
GTGAGTGAGGGCGGAGGCCCCTGGGTCCTCCAGGCCCTGGTCTGTCTCTTTCCTGACCAC
CTCGGGTGGGGATGAGGGGAAGCTGCAGCCCGCCTGCTGTGGGCATGGGCTCACCCAAGT
AGAGTGCGATGTGCTGAGTCCCTGTTGTCTGGCTGTGAACTGTAAAGCTCTTGACTTAAG
CCTGGGCTTCCTATCCTTGCTTATAGCCAAGGAGGGGGCCCCATGCACCCACCACCCACT
CCTAGTTGGGCACCATGCCTATTTGCATATGAGGAAAGTTACCTGGGAGAGGCCAAGTCC
TCCACCTGGAGTCCCAGTGAGTAGCTGAGTTCCAGATCTCAGATTCTAGAAACTTCCTTT
GCACCGGCTGTCTCAAAATCGAAGTAAGGAGATTGGTGGTGTGGGCAAGTGGCATCATGA
CGCTGCCCTGGAGCCCGCACAGTGGCACCGGGGCCCAGGCTGCTGGGAAGGAAGTGAGTA
GGAAGCGCCCGGAGATGGCCCAACACCCAGGGGCCACAGAGATGGGGGCCTTGGGAGGAA
CAGGGCGGGACAGACACGGTGGCCCAGGGTTGTGGCACATGGGGAGGAAGGGTTTGCAGA
GCTGGGGAGAGCACAGAGACCACCGGGAGAGGCAGGTACGATAGAAACAGGTGCACTTTG
CGCATCACAGAGGTGGGATGACAGGTGTGGGGTCGGGGGGCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1743..1874, 2064..2139, 2466..2595, 4027..4203
1007..1021, 1743..1874, 2064..2139, 2466..2595, 4027..4147
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved