Macaca_mulatta Locus ENSMMUG00000028844
snOPY snoRNA Orthological Gene Database
Macaca_mulatta ENSMMUG00000028844
Macaca_mulatta
ENSMMUG00000028844
19
SNORA68
3745..3877
5474
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGAGTGCGGGA
CAGAGAAGCCAATGGGCGTGCGGCATTGAGAGGGCGGGTCTTCCGGTAATGAAGGCCTGG
TGAACGGCTGCGCGAAAGAGGGCACTTCCTTTTGCTGGTGGCTGCGAGAGCGGAGAGGAC
GCCATGAAGGCTTCTGGCACAGTAAGGCGAGCGCGACGCGGCAGGGGGCCAAGAGATGGG
GCACGGGCCCCATCGGGGGTCTGCAGAGGTAGCGTGGGTCGGGTTGGTGGCGCGCGCTCC
TGTCGGTCCTGCTTGGCCGCGCGCCGCGTTCTCTTGTTGCAGTCAACATGGCGGCCATCG
TGGGCGCCGCGTGGAGAGAGCGATGCGTGGCCTGGGCCAGTTCAGGGATCGCGGGGGCCC
AAGGACTCCGGGTCTTTTTCCCGGGGGACGGAATAAGTCGCGCAGCGTGGAGGCCCGAGC
CCCGGCACCTCGTCAAGCCGCTAGGTTTCTGTTTTCTTGTCTACAATGTGGACGTGGCGG
TGGAGCAGTAGCATTTTCTTTTTCCCAGAATGACTGTGAGAAGCAGATGAAAATTGCTGA
CAATGAGCCGAAACGGGGAGCGTGAGGCTTAACGCCGTGACACATACTGGATAGAACCAA
ACGGCGTTATGGCGCAGAGATAGGAGAACCCGGACACCCATGGAGTGGGTGTGTTATGTC
CAGATCTCCAGCCTCAGTTTCCTTGCTGTTAAAGGGGCGGGCCCCATTGCCAGGGGCAAA
TGCCAGAGGCTACCAGGGCAGGAGAGTCTCAGAGCTGGTGGCGGGGCACAGGAAGACGAG
AGGATGCCCCGGGCCCCAGATGCTTCCTGAACGTGTGGTGCCGAGGCCGGTGGGTCAGGT
TCACAGTAAAAGTAGGAACTGAGTCTGCGATAATTTGTGACTATTTTTCATTGATACTAG
TAAAAAGCTGACGAGTCAGTATCAGAGGTGGTTTCTTTGTGCCATATCACAGAGCCTGGA
CTTGACCAAAGATTCTCACCTCTGCATCTGTAAATCGGGAGCCTTCCCTGGGCCAAACGT
TTGGATTGCCGTTGGGAAAACGGAGGCAGCCGCAGCTCGCATGGCGACAGTGCAGGGATC
CCAGGACTGGGGAGAGACCTGAGGTCTTGTCCTAGTTCTGCCTGGAATGGGCTGTGAGAT
CCCATACTGGTCACTCTGCCTGTGGGCCTCAGGGTGAAAGAAGATGTTGGCTGGATGTTA
TTAGGTGCAGAGTGGCTGCTTGACGGGGACTGCAAAGCAGTTCAGGACTGCAGCATGAAG
AAAGGAGACTGTGGGTCTAACTAAGCCTCAGCTTTCCTGGTCTGAAACCCTTAGCCCAGG
CAAAGGAGAAGCAGGCAACTTAATTAATTCTCCCTGGAGACCTCTCTCTCCTCAGTTCAT
TTTGTGGATAAAGCTGTGTTGGGGAGTGTGACCCACAGTCACCAGGAATCCACATGGAGG
CCCTGGGGGTGGCCCTGCCTCCTGCTGCCCGAATCTGTGGTCATCGGTTGCAGGCAAGGG
AGTGAGGTGAATCTCCACAGTTGCCGGGTGTGCTGGCCTTAACCTCAGTCCTGTTTCCTT
TCAGCTACGAGAGTACAAGGTGGTGGGTCGCTGCCTGCCCACCCCCAAATGCCACACCAC
CCCTCTACCGCATGCGAATCTTTGCGCCTAATCATGTCGTCGCCAAGTCCCGCTTCTGGT
ACTTCGTATCTCAGTTAAAGAAGATGAAGAAATCTTCAGGGGAGATTGTCTACTGTGGGC
AGGTATGGGGAGGCTGGGGCCATGTAGGTCTGGAGTGGATTTGCGCCTCATGGGGCATAA
TGCATCTCAAGAAGTAATCAGACATGGACCGGGCACGGTGGCTCACGCCTGTAATGCCAG
CACATCAGACATCAGAGCCACGGGTCGTGTTTCTCTCTGGGTCATGGGACTGGAACAGAG
CTTATGTGCCATTTCCCTGACTAGAAAGCCAGGGATTCAGGGAGGGGGTGGGTGGCATGG
TGGGATACCTTGGTTGGTGCTGTCTTCTCTGGGCCCTGTTTTATCAAGTGAGGAGAGGCG
ATGGCTATCCGGTCAGTGGTGGTAGCTAACTTGGCCCAGACAGGTCCCAGGAGACCTGAG
TTCAGGGACTGCATCTGGGGTGGGTTGGTCTCCGTGGAGGAAGCCTGGACTTCAGGCTGT
TGGCATGGAAAGTTCCCTTACCTGGCAGGCTCCCCAAGGGTTCCTGAAGGTGGATGGGGC
TGGGAAACTGAGGCACAACAGTCTGACCATAGAGTAAGCCTAGAGGCTGGGGTGTGCTTT
AGAGGCCGAGGGTTCAGTGAGGATGGGGCTAGGGCGGATCTGGCTCACCTCTCCGTGTGG
CCTCTCCTCGGCAGGTGTTTGAGAAGTCGCCACTGCGGGTGAAGAACTTCGGAATCTGGC
TGCGCTATGACTCCCGGAGCGGCACCCACAACATGTACCGGGAATACCGGGACCTGACCA
CTGCGGGCGCTGTCACCCAGTGCTGTAAGCTGTGCTTCCCGCCTCTGGCTTTAGATGCTC
CTTGATTCCCTCACACTGAGGCGGGGCAAATGCCAGAGGCTACCAGGGCAGGAGAGACTC
AGAGCTGGGGGCGGGGCACAGGAAGACGAGAGGATAACCCGGGCCCCAGATGCCCTTTTC
TGAGAGCCCTACCAGGCTCAGTTGTAAATCACATCGCATCTGGAAACTCCCATTTTGGGT
CTGCACCTTGTTTAGACTGGGGTCCACTTCACCACTGTCTTCTGGGACCCACTTACGACC
GAGTTCAACCCCTGCCCACTGTTGGGAGCTGGCACCTTTTCCTTGGCTCACCCGCCAGGG
TTTGTGAGACCCCCACACCTCCCTGATTGCACCTAAACCCAAGAATCACTGTTTCTTATA
GCGGTGGTTTAAACAGAGGTGCAAACAGCAAGCGGATCTCGTCGCCTTTGGGGGGCTGTG
GCTGTGCCCCTCAAAGTGAATTTGGAGGTTCTACAACTCTAGTGGCCAATGCCTGCTGGG
ACCCAGGCCTTGGGCTATCTCGCTTCCTCCCTACCACCTTCCCGTGAGCCCTGAGCCCTC
AGGCAGTTGCTGTGACCAACAGGATGTGCCAGGTCATTGGGCAGGCACTGAGCAGGAGGT
TTGCTGAATGCCCAGAGCCCAGGCAACACCGTTACACTGCCCCTCCTCCTTTCCACAGAC
CGAGACATGGGTGCCCGGCACCGCGCCCGGGCCCACTCCATTCAGATCATGAAGGTGGAG
GAGATCGCGGCCAGCAAGTGCCGTCGGCCGGCTGTCAAGCAGTTCCATGTAAGTGCCCTG
GGGGACTCCCCTGGAGGGAAGTACCTGCTCTGACGCAGGAGCCCAGTGGGGGGCGGCTAC
ACCTCGGTGACCCCACAGGGACGGGGTGTTAAGAGACTTCTAACCTCCTCAACCTGCCTC
CCCTCCTCACAGGACTCCAAGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGCCGTCAG
CACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTTTAGGTGCAGGGCTTTCGC
CTGGGTATGCCCCAAATAAACTCAGGAATGCCCTGGTGCTCACCGCATGTTTTCTTTGCA
CACACTGCAGAGCTCAAAGGGATGCTGTGAGAGGCTGGCCCAGTCACCTCCTGGGGTGCA
GCTGAGCTGCTGTTTCTCTGTCCTAGGAGGGGTTTTCAGTGCAAACAAACCCTCACATTC
TCCTCTCCTGGAGTGGGCCCTCCAGGAGCCCCCACCCCTGAGCGCCCTCTTGCTTGGTCA
GTTCTTAGCCCTGCTCATCCCTGGGCTATTAGCTTCAGGGGTACTGTCTGTCCTGGGCCA
CTAAATCTGTCCCAACTCTCTTGTCAGACACAGGCCTCTGAGGCTTCCCTCCTGAGTCTG
GACCAGGGAGAGTCTCCCTAGATAGTGGGATTGGGGGTCGCTCCCTGGGGATTCTCCTAA
GTCCCCAAAGTTCTCAGAGTAGACACAAGAGGGCACCCAAGGGGCGCGCTCTGCTGCTTG
GAGGCTGTTTTTCTCTTTCGCTGGTTGGGGGCCTCTTAGATGACACCCTAATCTTGCCCA
AGGAGGTCAAGGACTCACCACAGGTACTTGTCTCCAGGAAACCGCTTCAGGCCTGGAAAA
TTCCAGGCATGACACTAATCCCATCCTGGCTGAGTCCGTCTTGTCAGGTGGAGGCTAAGC
TGGCGTTGGAGAAGCTTGAGACACAGCCAAGAGCTCAGGCCCCCACCCATCCTTTGTTGT
GTGACCTTGGGCAACCCTGTTCTGGGCCAGTCTTGATCTGGGACTTGCCGTCTTGGTCTG
AACATGAGGTTCCGCACTGATGTGGGAGGTGCTGCTGTGCAGTTGCTGCGGGCAGCCTGT
GGGGCCCTCCTTTGTCCCAGGGAGCGCAGGATCAGGAGAAAGCCAGGACTTAGATAGCAG
TTACGGCTTTTTGAAAGAGGGTCTTGCTCTGTCATCCTGACTGGAGTGCAGTGGAGAGAT
CATGGCCCACTGTAGCCTTGACCTCCTGGGCTCAAGTGATCCTCCTGCCTCAGCCTCCAA
GTAGCTGGGACTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1608, 1699..2514, 2516..2641, 3254..3383, 4078..4187, 4332..4474
2449..2514, 2516..2641, 3254..3383, 4078..4187, 4332..4421
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved