Macaca_mulatta Locus NOL5A
snOPY snoRNA Orthological Gene Database
Macaca_mulatta NOL5A
Macaca_mulatta
NOL5A
10
SNORA51, SNORD86, SNORD56, SNORD57
1654..1785, 2623..2708, 3152..3222, 3467..3539
5918
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTGA
GTGCAGTCACTGATGTCTCCATGTCTCTGAGCAATGCCTGATGGGGAGGGGTCTAGGTAT
GCCATCCCAGCATGCTCCGTGGAAGCAGGGTAATCAGCTGAGGAGATGTTAGAATTGATC
ATCCTTCAGCCTGTGAGTGGGAACTGTGTTCTTTCCTCTGAGGGGTTGTTCATGAGGACC
TCCGCCTGCTCTTGGAGACCCACCTGCCATCCAAAAAGAAGAAAGTACTCTTGGGAGTTG
GGGATCCCAAGATTGGTGCTGCAATACAGGAGGAGTTAGGGTACAACTGCCAGACTGGAG
GCGTCATAGCTGAGATCCTGCGAGGTGAGACCATCATCTGTTATATTCATGTTATCCTTG
ACATTTTCGGGGAGGAGGTTCTGGAAACGTGGGTGCTTGTTGTGACTTCTGGGAAGGCCT
TGGACTTGGCTGGTGCCCATGGGTGCGGGAGCTAGCTCAGAGCCCCTTGTTGCTCACCGT
CCTGCCCTCTTCTTAGGAGTTCGTCTGCACTTCCACAATCTGGTGAAGGGTCTGACTGAT
CTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACACAGCTATTCCCGTGCCAAAGTTAAG
TTTAATGTGAACCGAGTGGACAATATGATCATCCAGTCCATTAGCCTCCTGGACCAGCTG
GATAAGGACATCAATACCTTCTCTATGCGTGTCAGGTAAAGTGCAGGGGCCACCCATAAT
ACTGGAGCCTTTGGTCTGTAGTTTAGCTAATTTTGAGTCTTGATGAGGACTGACCATCCT
GTGGGTAGAACTATGTGGACTGGGGCTGGGTCTAGGCCTCCTGGTGCTTACCACAGGCTG
TGTTCTTACACTGACTGTATAGAAAGAGGAGGTAGAGTAAACCTACCCTATATACACCTC
AGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAGAATGAAGATTTGTA
GCTCTATGGTTTTTGATGAAGCAGCTGGGCCAGGGAGTGACTGTGGCTCTTTGCAGGGAG
TGGTATGGGTATCACTTTCCGGAGCTGGTGAAGATCATCAACGACAATGCCACATACTGC
CGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATGAGGAAAAGCTGGAGAAGCTG
GAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCACGGTCCTCC
ATGGGTCAGTGCAGAGCCTGGCAGCCTGCATAAGGTATGGGGCTCTGAGTATCTGGCCTC
CTGCATTCACACTTGGTTTTTCCTAGGCATGGACATATCTGCCATTGACTTGATAAACAT
CGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAGTACCGCCAGAGCCTACACACTTA
CCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGT
GCGTCATGGGACACAAAAATGGGAGAATAAGGACTGTTGCCATGTGCACCTGCACTGCTG
TATTTCTTCACCCACTATGTCTTCCCTAGTTGTGCTTGATGGGGAGGTGGGGAGCAGGGC
TGTCATGCAACTGGCAGGTTAGCAGTTCGTTTCTCTGACTGCTTCCTTGACTCTTTCCAG
GTAGGTGCACGTCTCATCGCACATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCA
TCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACCTG
CCCACAATCAGGTGCCACTTCTGGTGCCCACTGCTTGTTGGGGGATCACGGTGATGGCTG
ACCAGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTC
TGAGTGATTCCCAGGGCCCAGCAAAGGGACCAAGTCTCCAGGTCAGCGACATCGGATGCC
TTCCCTCTGCCTCTGGGAGCTATGGGTTGGCATGCATTGGGGTAGAGATCCAATCTGGCC
TGAGGCTCACTCAGGACTTGGGGGTGAGAGGAGGGGAGGAGCTGAGCTGCCTTGGCTAAT
GGGGTTGAAATTTCTGATCTTAAACTCTCCACTGAATATTCTCTCAGAGCCCTGAAGACA
AGGGGTAACACACCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCT
GCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGA
ATCGATTGCTTCTCTGGTATGGGTGGGGGGGCTGGCAGTTGTGAGAAGGGGCTGGCTAGC
TGGGTGGGTGGGGAGGCTCACAACCATAGCTTCCACGATGATGGCAATATTTTTCGTCAA
CAGCAGTTCACCTAGTGAGTGTTGAGACTCTGGGTCTGAGTGAAGCTGAGGGCAGAGGGA
ACACAGGGTGGGGGTAGTTTTTCTCTTTGGGCTGACAGGCTTTGTTACTCACGCACATCC
AGAGGTGCCCACGAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGACTGTC
CTTCTATGAGACTGGAGAGATACCACGAAAGAATCTGGATGTCATGAAGGAAGCAATGGT
TCAGGTTAGTTGGGCTTTGCTGGGTGTGGAGAGGCATAGCTAGCTGTTGGAGGTGATGAA
CTGTCTGAGCCTGACCTCGTAGAGTGGAGGCAAAAAAAACTGATTTAATGAGCCTGATCC
AATAATGCCAGAAAGGAGTCCTCAGAGCACCAAAGGCCTTCAGGCCCTTTTAGCACTTTT
CTTTGACCAGGCGGAGGAAGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAA
GAAACGCTTAAAGAAGGAAAAGAAACGGCTGGCTGCACTTGCCCTCGCATCTTCAGAAAA
CAGCAGTAGTACTCCAGAGGAGTGTGAGGTCAGTAGGCAGCATGACCCTGGCAGAGATCC
TAGGTTGTAGGATTTTCAACAGCAGAATAAAGGATGTGCTGCATCAAGTCATGGTCTTGA
GTCCAGGCTTTTGGACTGAAACAAGGACCTGAAACATCTAAAACTACCTCTTGATTCTAT
AGGAAGGATATAGGTGCTGAACTTGCTCAAGAGCCCAGAGAGCTGGTTGTAGCTCACACC
TGTTCCCTGGGCATGTGTGTTCTGTCCTCGGCTGCTTCCCAGGAGTCCTCAACCTGGGGT
AGTGTAAATTCCTGCTCTGCTTATTCTCAGACGTGTGTCCGGAGGTGGTAGTGTTTCACA
GTGGGGATGGGGGCAGGGAGGTCCCCAATGTGCTAAACTGCAATCATTCTCCCTGAGATT
TTCATTTAGCACCCAGTTTCTTAAACAGTGTTTCAGGGCCCTGTCTGGAACTTGGCATGA
GGGTTCTGTTGTGACCAGCATGGTGGGTGTTTCTTTAGGTTTTTTTTTAATGGGCTGAGG
TAATTTCTTATTACATGTTTTCCTTCTAATTTGGGACAGTCTTTGGGATGGATCTCTAAA
GTTAATACCCACACAATTAAACTATGCCAGAAACACTGGGCAATGTCAGTAACTACACAG
TTTTCCCTGCTTTGGCTACTTAATTGCTGAAGATGTAATGGGGGTGTGTGTGATGGCACT
GTTCTCACAGCCTGTTCCCCTGTCCTTCCCTTTAGGAGACGAGTGAAAAACCCAAAAAGA
AGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAAGACCCATCTATCC
CTTTCTCCAAACCCAAGAAAAAGAAATCTTTTTCCAAGGAGGAGTTGATGAGTAGTGATC
TTGAAGAGACCGCTGGCAGCACCAGTCTTCCCAAGAGGAAGAAGTCTTCACCCAAGGAGG
AAACAGTTAATGACCCCGAAGAGGCAGGCCACAGAAGTGGCTCCAAGAAAAAGAGGAAAT
TTTCCAAAGAGGAGCCAGTCAGCAGTGGGCCTGAAGAGGCAGCTGGCAAGAGCAGCTCCA
AGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGCAAATGGACATTCTC
TGGGAGGTGGGACATACCATAGCCCAAGGTGACATCTTCCACCCTGTGCCCTGTTCCCCA
ATAAAAACAAATTCACAAAAGTTGGTTCATGTTCTTTATTGGACACCTTACATGAGTATG
GACAAGGCCTATGGGTGGGGCAAGGCAGCAATGACAGCCTCAGTGAAGTCATGGCAAGTA
GCATAGCCACCCATGTCAGAGGTTCGAACCTGTGGGGGAGAATCATCATCATCCATGTGG
CCTGGGTTCCAGCCTAACAATTCCCATCACCACCCAACAGTCTCCCCTAAGGAAGCGGGC
CAGGACAACCTAGGCTCTACCCAGCAAGGTGACCATGGTCCACTGCCTAGAGGCACAAGG
TCTCTTCCCTGGTGCACTGCACTGAAGGGTATGGGGAGTGTGGTCCTTGCAAGGCTGGAA
GAAATAAAGGGCTCTAGCTCCCATGGGGGTGCAGGTGACCGATGACAGACTTGATGAAGT
CGGTTGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGCACCTACAGCCACCACCGGCAAC
AGCCGTGGGGAGGGAGAAAAGAGAGCCCATGAAGGGAGATAGGGCAATGTGATTGAGGAA
ATGGAATCCAAGAATGCGTGACAGCCAGAAAAAAGAGGCAATGCACAGGAATGGAAGGAG
GAGCCAGGTTGGGAAGCACATGGACCTGCCCACTCCTCTTAAGCCACTATTAGCTGTGCT
GCAGCCAGAGCAGGACAGGAGGCTGAGCAGGCAAAGATGATGGGAAATGCAGATCAGAGG
CGCAATGTGGCTACCTTCCTTGGAAGAAATAGAGACAAGACCAGGTGGAAGGAAAGAATC
GCAGCGGAAAGGAGATGGGTGTGAAGGTGAAGCTGATGCTTCAGCCTGCCTGTATCCCTT
GCTGTTCCACCCCCAAGGAGAGCTGCAAGTTCTGCATTCAGATGGCCCATGAAAAGGGCA
GTGGATGGAGCAGGAAAGAGGGAACAGCAGATGGGATCTAAGAGGCAAAAGAGATCAAGA
GGATGAAACAGCCAAGAGAAGGGAGGTGAAGAACAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1163, 1336..1534, 1856..2043, 2126..2277, 2460..2560, 2927..3075, 3302..3423, 3610..3747, 4475..4918
1001..1163, 1336..1534, 1856..2043, 2126..2277, 2460..2560, 2927..3075, 3302..3423, 3610..3747, 4475..4837
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved