Macaca_mulatta Locus NCL
snOPY snoRNA Orthological Gene Database
Macaca_mulatta NCL
Macaca_mulatta
NCL
1099214735620
SNORD82, SNORD20, SNORA75
4906..4975, 9160..9239, 9749..9885
11789
TCTGTAGGAACAATGAGGTATGGATGGATCCATACCTGGACCCATGGATTGGATGGATC
CCAGGCAGGCCCTGGACGGAGGGAAATGCTCTGTTGCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCTCGCACAGACC
CGCGACTGCCTTTATTAACGGCTCTCAGAAGGCTGCCTGCAGCCGGGGGTGTCTCCAGTC
CCATGCTCGCGGGCAAGCAGGGCTGAGCTGTGCCTCCGAAAGGGCCAACGGGAACTCCGC
GGTCCCTGAACTTCCGGGGCTGGCGGGCTTCTTTCTCCAGGGCCACCGGGAGCCCCGGCG
TGAGTGCGTGCCGGGGCCGCGCGCGGGGTCTTTGAGGAACTCCAAGGCTGCCCGAGCCTA
GGGAGCCAGCCACATTGGAGATCCCTAGACCGCCCGATTCCACCACCCCCGAGGTCCCCT
CACAGCCGGCGCCAAAAACGCCAGTCCCACGGCGCAGGCCGGGACCCGCGCGCCCACGGC
CCAATCAGCGCCCGCCTTGCACAAAGCGAGCCCCGCCCCCACGGCACGGCTGCCAGCCCC
TCCCCCTCCCGTGGCCGCCTCGGCCCGCCCACTCCCCGCCCCGCGCCGTTCTCGGTTAGA
GGCTCGCGATTGGCTCAGGGGGACTGCCGCGAGCTCTGGTTGGTCGGCACGGAGTCACGA
GGGCGCCGTCGTCGCCTTTCCACAGGCGATTACTGGGCAGGCTCAGTCTTTCGCCTCAGT
CTCGAGCTCTCGCTGGCCTTCGAGTGTACGTGCTCCGGGATCTTCAGCACCCGCGGCCGC
CATCGCCGTCGCTTGGCTTCCTCTGGACTCATCTGCGCCACTTCTCCGCTCCACACTCCG
CCGCCATAAGCCGCCATCATGGTGAAGCTCGCGAAGGTAAACGGCCTTGAGCGCGAGCGC
AGACGTCTAGGCCTGCTCTCCGAGGGGCGAGCGCGGCGGCGCGGGGAGGAGGGCCTGCGC
GCAGTCCCGGGCGCGTTCTAGGGCGCCATGCTGCGGGAAGTCTCGCGCGATTAGTGGGGA
GGTCTCGCGGCTTCTGGCTAGTTGGTGGCGAGGTGAAGAGCTTCTGCAGGTGCTGGGGGC
GGCGAACGCGGCGGGAAAGACGGAGTCACTGAGCGCGGGGAGGGGGCGCTGGGCCCCGGG
GTGGGGAGATGAGACCAAACTCCTGCGACGCATACGAGTCGGGACCCGACTCCTGACGCA
CGTGCCCGGGTGCGCGGCCTGCCACGTGGGCCGCGCCGCGTGGGTCCTGGAATCTCCAGA
GGCACCGGTGCCTTGCGCCAGGAAATGGCGGTATCGGCCCTAGTCGGAGTCCTGGCCTGG
CAAGCCGACACGTGGTGGGCCCCGGAAGGTGGCTCTGCCGCGTGCCTTTTGCGCCGTGTT
TCGGGCACGTGGTGGCCTACCAGGTACCCCCACGTGGCCGCGCCGCCTCTTTAAGGGGCG
GGGTTGTCTTGCTGGGAAAAGCATAATGTTCATGAGAAAACCAAGGTAGTTACTTCTTAC
CTTCGGGCGGGTTTTCTGTTTGTGAAGCCCGGGAGGAAAATTGTGGGCGGTTGAGAGTAG
TCCATCTTGCATTGCCATCAGGACTCGTTTTGATGTTGTGCTGTTTGGCACTATGAGAAA
TGGATCTGAGAAAGGAGAGATGATGGCGTTTTACTATGAACAGTAATGGCAAAATATGAA
TGGCCTGAAATGTTGAGGTGGAGGTGTAATGACCTACTTGTGTCCATTTTAGGCAGGTAA
AAATCAAGGTGACCCCAAGAAAATGGCTCCTCCTCCAAAGGAGGTAGAAGAAGATAGTGA
AGATGAAGAAATGTCAGAAGATGAAGAAGATGATAGCAGTGGAGAAGAGGTAATTTTATC
TAGCTTAATGCAGAATTGTGTTAAAACTACAACAATGGAGAGTTAAGACATGAAATTGGA
TGTCTGTGGCTAAAATAAGATTTTATTCATCCAGGTATGTCCTATTGTAGTGGTGGTTTC
ACAAGCTCTTCACTGACATGTCAAGGTGTCATTTGGCTAAGTATTTGAATGTGAGTTTGA
GACAAGAGGTCTGGGGATCTCCTTTCCATGTGCCTCTGCAGGGCAAGGAGTGTGATTTGT
TGTGTTAAATCATTAAATTTTTCCAGTTTCAACGTGTTAGCCTCACCCCGACATGTAGAG
CTGGGCATTGTATTCAGATCTGAGGATAACCTTCCCAGATTCCTTTCCTAGCCTCCAATT
AAGATTAATTGGTCTCCATTCCATTATATATAAACTTTGTAATTCTACTCACTGCGTTAT
AGTTATCTTTGGTGTAGACTGAGGGCTGCCACCTCTTTGTGTTAACATTGACCCTCTTTA
CTCTTTGGCAGTCCTGGCCTTTTATTTGCTCACTGTAAAGACATCTGAGCACTGAATTGT
GCTCAGGTTTCTCGTTGAGAATTGAATAAAAGTTTTATTCTTCCACACATTGCCTAATAA
AACTATGGGATTTTCATGTAGCTAAACGATGGCTTTTATCAAACTAACATGCTCACTCTT
TGATGTGTGATAGTTTTGTAAGGGATAGTTATGTTTAGCCTATTTGATCTTCATTTTATC
TCAGGTCCCAAGAATTGAGCTTCACTGGACTCAGTACTGCCATCCACCATAGGAGCCCCA
AATGATTTAATACGTTAATGCTTGGAGCCTCCTAGGTGTAAGGTTCTGAATAATTTACGC
ATAGCAATTCATTATTGTTACACGTGTAATATGATACTATTACCATTTTCAGATGAGAAA
GTTGGGGTTTGGGAAAATATGAGGTGCAAGAATTCAGAGGTCTGGTTCAGAGGTATTTTA
AGTGTTCAAAAGGGTTCCTTATGGCTGGGTATTCACCTGATAATAAGGGCTCTGACCTAA
GACAACATAACAGAAGCCTGGAGTTTAACATGCTAACATGTGTCTAGCGCATGTGGTCTT
GAACCAGAAGCATTGCCAGAATCTAACACTCACTGGGACCATGGTTATCTTTTTGGGTGT
GGGGCTGGACTTACTGGTTTGGTTTTCATTTATTCTCAAGGTTGTCATACCTCAGAAGAA
AGGCAAGAAGGCTGCTGCAACCTCAGCAAAGAAGGTGGTAGTTTCCCCAACAAAAAAGGT
TGCAGTTGCCACACCAGCCAAGAAAGCAGCTGTCACTCCAGGCAAAAAGGCAGCAGCAAC
ACCTGCCAAGAAGACAGTTACACCAGCCAAAGCAGTTGCCACACCTGGCAAGAAGGGAGC
CACACCAGGCAAAGCATTGGTAGCAACCCCTGGTAAGAAGGGTGCTGCCATCCCAGCCAA
GGGGGCAAAGAATGGTAAGAATGCCAAGAAGGAAGACAGTGATGAAGAGGAGGAGGATGA
CAGTGAGGAAGATGATGAGGATGATGAGGACGAAGATGAGGATGAAGATGAAATTGAACC
AGCAGTGATGAAAGCAGCAGCTGCTGCCCCTGCCTCAGAGGATGAGGATGATGAGGATGA
TGAAGATGATGAGGATGAGGATGATGACGATGAGGAAGATGGTAAGGAGTTGTCTTGGTA
GTTACTGGGCTTCTGATTGCAAGATATCTTGAGATTCTGGGATCAACATATTCCACAACA
ACCTGGAGATGAGAGTAGAGTCCTTGTGGGAATTCTCTGGGCTGTTGTGTGTTAGACTTA
ATTACCCATGAATGATTTTTGTCCCTCCTGAGAAAATTTCAACAGCACATTCTGTGAGTG
TTTTTCATAATGTAGGATTTTGTTTCTTAGTGATCTTTTTTGTTTTGTTTTTGTTTTTTA
ATTTTTTTGACATGGGAGTTTTTGCTGTTTCCTAGGCTGGAGTGCAGTGGCGCGCTATCT
CAGCTCACTGCAACCTCCATCTCCAGGGTTCAAGCAGTTCTGCCTCAGCCTCCCAAGTAG
CTGTGATTACAGGCGACCACCACTATGCCCTACTAATTTTTGTATTTTTAGTAGAAACGA
GGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCTTGACCTCAGGTGATCCACCCACCT
TGGCCTCCCAAAGTGCTAGGATTACAGGCGTGAGCCACTGTTCCTGGCCCCAAGTAATCT
CTTCTTGCCATGACTATTAACTAAACATGGTGACAGGATTGCATTAGATTTTAAAACCGA
TGTTGGTTTTGGGAGATTGCTGCAATTTTTAGGTGGCTTATCTTTCAGACTCTGAAGAAG
AAGCTATGGAGACTACACCAGCCAAAGGAAAGAAAGCTGCAAAAGTTGTTCCTGTGAAAG
CCAAGAACGTGGCTGAGGATGAAGATGAAGAAGAGGATGATGAGGACGAGGATGATGACG
ACGATGAAGATGATGAGGATGAAGATGATGATGATGAAGATGAGGAGGAAGAAGAGGAGG
AGGAAGGTAATTAGATTCTGACATACATTGACATGAGTTGTTTAAAGGAGGCACTTAAGT
GTTTGTGGCTATTGATGGGTAATACATTGACATCTTGTCCAGAGCCTGTCAAAGAAGCAC
CTGGAAAACGAAAGAAGGAAATGGCCAAACAGAAAGCAGCTCCTGAAGCCAAGAAACAGA
AAGTGGAAGGTAACTTGCAGAATTAGGGGATGTGGGGGAGATAAACAGCACAAATGATGA
ATGACAAAGGGACTTAATACTGAAACATGATGTTACATTGCAGTGTGCTGATGTGCTGTG
TATAGAAATTTTGCTTTGGAAACTAACTTTTTACCACACTTCACAAGTAGACTGAGTTCA
GCTTTTTTTGTATAGGCACAGAACCGACTACGGCTTTCAATCTCTTTGTTGGAAACCTAA
ACTTTAACAAATCTGCTCCTGAGTTAAAAACTGGTATCAGCGATGTTTTTGCTAAAAATG
ATCTTGCTGTTGTGGATGTCAGAATTGGTATGACTAGGTAAGTGCTTCATGCACATTACA
TACACATGGGTCTGTTAATACTTTTCCTTCCCTTATTAGCACAGTTACTTTAGCCTGCCA
CTCCTAAACATGAATAGTGTAAACATTTTCAAGGATTAGCATTAGTGAACTAAGTTACAA
TTAAACTATAGAGTCCCTGGATTGCAATTTCCAGTCAGTTGTAACTTGGTATAGCACAGA
ATAATCTTAGTAAGTTTTTTTGTCTTTTTTGTTTTGTTTTGTTTTTTATTGAGACGGACT
CTGGCTTTCGCTCAGGCTGCAGTACAGTGGCGCAATCTTGGCTCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAC
AGGGTTTCACCATGTTGGCCAGGCTGGTTTCGAACTCCTGACCTCAAGTGATCCACCCAG
CTCGGCCTCTCGAAGTGCTGGGATTACAGGCGTGAGCCACTGTGCCCAGCCTAAATTGGG
GTCTTGAGGCACCAGTGTTGGTGTTAGGCAGGAGAATCGCTTGAACCTGGGTGACGGAGG
TTGCAGTGAGCCAAGTTCGCACCACTGTACTCCGCCTGGGCAACAGATCGAGACTCTGTC
TCAGTTTAAAATAATAATAATTTGATGTTTATTTTCTTGGAAGTACCTGAAACTATTAGA
CCTGACTAGTCATCATAGTGAATGCTTTTATCCAGGCAGGATTCTCCTGTATTAGTGCTT
ACAGGTGTTCTTTTGTCAGCTGCTACTGTGAATTGTTATAAGCAATTTAGCTAATGATGA
TGACCTCAAACGTGAATGTGCACGTCATATCTCCGTACTGAGACCTTATTCTGTAGCTAC
AATTTGCAGAGCCTTGACTTTGTTTTGCTAATATTAGGGGTGCTTTTTAAAATGTGATCT
TTGTTTGCATCATCACATTTGTCTAGAATACATATTGTGGATTTCAGTTTGTGTTTTCAT
CTGTTGTAATTTTGCCCTTCTCTCCACCTTGAAGGAAATTTGGTTATGTGGATTTTGAAT
CTGCTGAAGACCTGGAGAAAGCCTTGGAACTCACTGGTTTGAAAGTCTTTGGCAATGAAA
TTAAACTAGAGAAACCAAAAGGAAAAGACAGTAAGAAGGGTATGTAAGGCTTTAGGAGAT
TATGCAATAAATTCAGGAGCTAGACTGCTAGGGAAAATGCTTTGTAACCCATTTCCCTTG
GTTTCCTCTCTTTAAATTTTTTTTTCCCCTTGGTTTCCTCTTAATGTGGGAATTAAATGA
GCTGGTGTTTACAAGAGTACTTGGCACTGCTTGCTAGTGTTACAGTGTAAATTCTTGAGT
TAGGCAAGCAAGAGCACTTTTATACAGAACACGAATTATTAGATGCACCTAAATTAATGT
AAAGGGGTCTTCACTGAAACTAGATTAGGTCCCTAATTACTGTTTGCATCCTTTACTTTA
TTTCTCTATGTACAGTTGTAATGTTGTAATGTTTTAAATTGGTACGTTCACCTTTTTTGT
TTCTAAAAATAATATGCATCTACTCCAGGTTGAACTCTAGTGTACCCAGCGGATAGTTTG
ACATCAGCTGTGACAACATGGAGGGACCACTTGTGTGTTGACACTGCTATATCTCCAAGG
CACAGAGCCTTGTACATTATAGGATCTCAAATTATTTGTTGAATAGAGCTATGTCTTTTT
TTTCCCCCTCTTTGTTGTTGCCCCCCACCTTTGGTTTTTCAGGCCATGGAGCTCATTTTT
GTTTTTTTAATCTAGAGCGAGATGCGAGAACGCTTTTGGCTAAAAATCTCCCTTACAAAG
TTACTCAGGATGAATTGAAAGAAGTGTTTGAAGATGCTGCGGAGATCAGATTAGTCAGCA
AGGATGGGAAAAGTAAAGGGTATGTTCTGTCTATTGAAATGTAAGGGTTTTCTTAACATG
AATACACATTCCTGCTTTATAAAAGAAATGTTGGTTTGATTTTCTTAGGTGTGTAATTTT
GGGCAGTTTAACCTGTAAATTTGTGCCTCAATTACCCATCTGTACCATGGGGATAACGTA
CTCATAGGGTGATTTTAAAAGACAAGGTAATACATATAAAGGAGCAAGAAATGTGCCTAG
CTTACAACAAATATTTTGTGAGTAGTAGTTCAGTGAGGTGAGGTTACTGTGAAAAAATTT
TGAGTATTTGTAAAACTGTAGTGGGAAGTAAGAGGGAAGCTCAAGTTTGATTGAAAAGTA
GCATAAAACTAAGGGCATTTATTGTATTCAGATCTGAAGCAAGTTCTGTGTTGCTGAGGT
ATAAAAGCATTTGTGTTAATGTGATTTTAAAAACCATGAGTTCTTCTCCCTCCATTGCAG
GATTGCTTATATTGAATTTAAGACAGAAGCTGATGCAGAGAAAACCTTTGAGGAAAAGCA
GGGAACAGAGATTGATGGGCGATCTATTTCCCTGTACTATACCGGAGAGAAAGGTCAAAA
TCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTAAGAAATTAGGCTTGTTACT
GGGTTCCAGAATTGATGGAGGGAACTCCTTTGTGTCTTTGTACTTCATAAGTTTATACTT
TTTAATCAAAGTTACTTAAATGTAGGTGAAGATCAAGGACATTATACCCTAAGTTATACT
CTTATTTGGAATAGTAATTTCCAATCTTGAATGAGAGCTGTAAAATCATTTTGCATTGGA
ATACAGTAGGCAAATCAAGCTTCCTTTTTGTAGGTATGTTTTATACTTTAAATGACTTCG
ACTATGTGTGTGTGTGTGTTTTTTTTTTTTTTTTGAAACAGTCTCGCTCTGTGGCCCGGG
CTGGAGTGCAGTGGCCGGATCTCAGCTTACTGCAAGCTCTGCCTCCTGGGCTTACGCCAT
TCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGCGCCCGCCACCTCACCCGGCTA
GTTTTTTGTATTTTTTAGTAGAGACGGGGTTTCACCGTGTTAGCCAGGATGGTCTCGATC
TCCTGACCTCATGATCCGCCCATCTCGGCCTCCCAAAGTGCTGGGATTACAGGCTTGAGC
CACCGCGCCCGGCCGACTATGTGTGTTTTGAACTCAGATTATTGTTCTAGGAAAACAGGC
CAGTAGTCAGCCTATACATAAAGAACCACCACCAGAACATTGCAACATGTACTAAGTACT
TAATATGTTGAGTAACAAAAGTGGATTTCACTTACATCATCAGTATTTGTGTGTTAACTC
TTTCAAGCACTGAAATGCTTAGGAATAAAATATTACTGCTCTGACCGAAGCTGGGAACCA
CTGTTTCAGAGTCTTAGGAATGTGGCATCTCTATTTGCAGGTGAATCAAAAACTCTGGTT
TTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCA
ACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTAAGATAATTAATAC
CTTTATATCAGTTACAGGCTATATATGTCTTACAGGTCTAAAGGAACGTAAGGTCATGTG
ATCCTGTCAGAAAAGCCAAATAATTTTAGCTACATAAATGAGTGTAAAAGAGCGTCATTT
AGGTACCAACTTGAGAGAAGGCTTGGCAGCATCTTGTGACAGTGAAGGAGCACGTGCTTG
GTAACTTACTCTAAGCATTAACTGTTCATCCTCAGGTATGCATTTATAGAGTTTGCTTCA
TTCGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCA
ATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCGTAAGTTCACC
TGGATAGGATGCTGTGGTTGGGGGTAGCACTCTCAGTGCTTTTGGTGTTTATTTTTTGCA
CAAATTCTGTGTTTCCTGTTGCTACTGAGTGAACAATAACTGGATATGATGACTGATTAC
CTGAGAAATAATTGATGAAATCTCAAGAAGATTCCTCTAGATAGTCAAGTTCTGATCCAG
CTGTGTCAACTCAGAGCAGCAAGTTTGCCCATGATTTCCTGCCCCATCCAGTGGGCAGCA
CCTGCTTGGGTTCTTCTCCCACTTTCCATAGAAGATGTGGGGCAGAATATCAACTATGCA
GTGGCAGTTTAAAAAATGTAAACTCAGAATAGCCTTACTTTAATTAAGGACTAGTTGGCT
TAGTTGCTTTTCACTGCTTTTCCACTAAGACAAGCATTCTTGGCCAGTAGTCATACCAGG
CATTGTGCAAATTCAGTGTTACTACGAACTGTGACTTCACATAAAGTCACAATTTTTTTT
CTTCCCCAGAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAG
AGACATTAAAGGAGTCATTTGACGGCTCTGTTCGGGCAAGGATAGTCACTGACCGGGAAA
CTGGGTCCTCCAAAGGGTAAGGGAAGAAAGCATGAGTGCTGCTTTCACTTGAAGGGGTTT
TTGTTCGGTGGAGACCTTGAGTCTAAGGTGTCTTCTCATTGAGCTCCTTTCTGTCTATCA
GTGGCAGTTTATGGATTCGCACGAGAAGAAGAGAGAATTCACAGCACTAGCATTATTTTA
CCTTCTGTCTTTACAGAGGTATATTTAGCTGTTTTGTGAGACATTCTGGGGTTCAAGCTG
TCACACCAGTTAGTTTTCCATAGAGAGCTACTCTGTCACTGGTATATTTTCCCAACTAAA
CAAGGCTACTTTCTGTGGGATGGCTCCCCAGTGTGTGCCGTTAACTTGGGACATGTGCAG
TAGGTGCTTTTTATAATGGGCAATTTCATTTGGTGTTCTAGGTTTGGTTTTGTAGACTTC
AACAGTGAGGAGGATGCCAAAGCTGCCAAGGAGGCCATGGAAGATGGTGAAATTGATGGA
AATAAAGTTACCTTGGACTGGGCCAAACCTAAGGGTGAAGGTGGCTTTGGGGGTCGTGGT
GGAGGCAGAGGCGGCTTTGGAGGACGAGGTGGTGGCAGAGGAGGCCGAGGAGGATTTGGT
GGCAGAGGCCGGGGAGGCTTTGGAGGTAAGGCACACAGGGATAATGACTTCAATGTCTAC
TGGACACCACGTAGCATATGCTCTTTAGACCGTGCCTTGTCACGGTTCCTAATCACTGGG
AGGAGGAACTTTGTACCTATTCTTTTAACAGTGTCTTGCCTTCCCCCTGTAGGGCGAGGC
GGCTTCCGAGGAGGCAGAGGAGGAGGAGGTGACCACAAGCCACAAGGAAAGAAGACGAAG
TTTGAATAGCTTCTGTCCCTCGGCTTTCCCTTTTCCATTTGAAAGAAAGGACTCTGGGGT
TTTTACTGTTACCTGATCAATGACAGAGCCTTCTGAGGACATTCCAAGACAGTATACAGT
CCTGTGGTCTCCTTGGAAATCCGTCTAGTTAACATTTCAAGGGCAATACCGTGTTGGTTT
TGACTGGATATTCATATAAACTTTTTAAAGAGTTGAGTGATAGAGCTAACCCTTATCTGT
AAGTTTTGAATTTATATTGTTTCATCCCATGTACAAAACCATTTTTTCCTACAAATAGTT
TGGGTTTTGTTGTTGTTTCTTTTGTTATTATTTTTTTTTTTTTTGCGTTCGTGGGGTTGT
AAAAGAAAAGAAAGCAGAATGTTTTATGGTTTTTGCTTCAGCAGCTTTAGGACAAATTAA
AAGTCAACTCTGGTGCCAGACGTGTTACTTCCTAAAGAGTGTTTCCACTGGAATGTCACT
GGAGAGCATGGCAAAGCCAGCTCTGCCACTCACTTCACCCATCCCAATGGAAATGGCATA
GTGCGTGCGTTTCCAGTATCCCAGCCCCCAACTTGGTTGAAATGCTGGTGAGGGGACCCA
CTCCTGCAGCCCTGATGCTGATGAAGGCTGCTGCAGCTTCTCCCAGTTTCAGCAGGTCTG
AGGATTATGTCCTGTAGAAGACTCTGGAAAGAGGCGCAGGAACACATTAGGTCTCCTAGG
ACAAGGAAGGGCATCTGGGAAGAGCAGTGGCTCACACCTGTAATCCCAACACTTGGGGGA
GGCCGAGGTGGGCAGATCACCTGAGGTCAGGAGTTGAAGACCAGCGTTGCCAATGTGGTA
AAACCGCATCTCTACTAAAAAAAAAAATTAACGGGGCGTGGTGATGTACTGCTGTAGTCC
CAGCTACTCAGGAAGCTGAAGCAGGAAAGTCACGTGAACCCGGGAAGCAGAGGTTGCAGT
GAGCTAAGCACGCACCACTATACTCCAGGCTGGGTAACAGCGAGTCTCCAAAACAGTTCT
GGAATAGAACTCATGCTAGGTGGATAGACCAGTGGACACTCAGGGACCATGCGGCTGGGG
AGGAAACCACATCAAGTAAACCCCTAAAAAGCCATTTGTTCTGTACTATGTATATTCTTT
ATTCTTTCTGGTCTTAAGTACTTGCCTCAACCTCCACTTTTAGTAAAAGACGAAGGCCAC
ATGAGAGGTGGGACTATCAACAACGTGATGAATTTAGATGAAACCCAGTGCCCAAAATCA
ACATAGGTAGCCAAGTGCAAAACCCTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1175, 2032..2148, 3340..3827, 7560..7717, 8560..8683, 8915..9048, 9549..9675, 10061..10284, 10432..10789
1158..1175, 2032..2148, 3340..3827, 7560..7717, 8560..8683, 8915..9048, 9549..9675, 10061..10284, 10432..10505
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved