Macaca_mulatta Locus Mono:333:SNORA11
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:333:SNORA11
Macaca_mulatta
Mono:333:SNORA11
5
SNORA11
1001..1127
2127
TTTTTTTTTCTCTAATAAATAGTTTTACAAAGGAAAGACATAAACTTTAAATCTGTGTT
TTAAGAAAGATGAGTTTCAAACAGATATAGAAAGTATTATGCAAAGTTTCTGATAAATAT
GTAGTACAAAAAGTATATATTGATATGCTATCTGTACCTGGAACTGTATAAAGCAATGTA
CTAAGCAAGAAAATAGAGAGAAAGCTCCTGCTCACTCAAAAATATAAAAAGACAAAAAAT
CAGCTGCTTATTAAATGATTACTAATCAAACTATATTAACATTTTAGTCCATCATCATAT
TAACATAAATTTACAGTGAGATAATTCCTTTCAGTCTTTTTTTTTTCTTTTTGAGACAGG
GTCTTGCTCTGTTGCCCAGGCTGGAGTGTTGTGGCACAATCACAGCTCACTGCAGCCTTG
ATCTTCCAGGCTGAGGCTACTCTCCCACCTCAGCTTCCAAGCAGTGGGACTACATGGAAA
GCATGTGCGTGCCTGGTTAAATTTTTAACATTTTTTTTGTAGAGACGAGGTTTCAGTATG
CTCAGGCTGGTCCCAAACTCCTGCACTTAAGCAATTCTTCCGCTTTGGCCTCCCAAAGTG
CTGGGATTACAAACATACAGTAAGATAGAAGAAATAAATTCAATGATTTATAGCATAGGA
GGGTGACTATACTTAACAAAAATGTTGTATTGGGGTGACAGACACTAGAAATACCCTCAT
TTGATCACTATGCATTATATACATGTACCAAAGTTTCACATATACCCTGTAAATTTGTAC
TAATAAATAAATAAGTAATAAATATTAAGAAAAACAAACCAAGTTCTGTCAAAAGACTAT
TAGCCCGGGAAAATATAGTTGGTCCTTTGTATTCAACTGTGATAGGTAATATTCGACAAA
AAAATTTTACAACCCACAGCAATAAAAATAACATCAAATAAATATAGTAGGACAATTATA
TACAGAGCACTCACATTATATTAGGTAGTATAAGTAATCTAGGGGTTTGCTCAGAGCAGG
GGGCTGAAGAATGGCTCCTCTGTTTACAATACATGGAACAGGCATCTGGGGTCACTGTGA
CAAGGGGCACAAAACTTGTGGCTCCCTAAGAACAAATGTCCTACATGTGTAACAAAAAAA
GTAACCCAGAGATGATTTACAGTATATGAGAGGATGTGCGTAGGTTTTATGCAAATATTA
TGTCATTTTATATAAGGGACTTGGGCATCCACAGATTTTGGTATGAGGGGATGGAGTGGA
GTCCTCAAATCAATCCCACTTTGTATACTGAGGGACAACTGTGTATCTAATATATATATG
TGCCTCCATCCCCAGAAGGGTGACATTTGAAAAACGACACTAATAAAAACAGATGAAAAA
TAGAATAAAAGGCATAGTGTTTGTCCAGGGTTGCATACACAGTAAAAGACAAATGACAGT
TTAATTCTCTGACTTTAAGGATCCTGAGCAAAACTAGCACCCTCTGCCCTCATGTTCATA
TAAAGTCAGTCCTTCTTTCCGCTGTCATCCATTGCTTCTTTAAACAAATTAGATCATTGT
CTTTAAATCAAGTAACTGCTAACTATAGGCTTTGAAATGTCCATTTTTAATGACAGCTTT
TATTCTAAGTATATGTCAGACTCCATATGAGCGGCAGCACTCCTAAAAGCATTAGCTTCC
ATATCAGAATGTCCATTCATTTTTGCCTACCTGCTGGCTAACTACTCTCAGATACAGGTA
CTGCATGCTATTTTTGTAAAAGCGCAAAAAAGTCTTTCTGTTTTCTATTTTACTGGCACG
ATGCACAGCACAAATGGATGTTATGTCCTCAAAGGGTTGAGTGTTCTTTTAGGAATGCAA
AGGCCAAGACTTGACTCTCACTGGGTGAGCAGTGTGGAATGTGACAGCTGGTTGCTTCAG
GGCAACTGATCATTGCCACAGTGAGCAATTTCTTCTTCAATAAGCAGCTGCCCCAGACAT
TTTCTGAGGCCGTACATCAATCCCAATACATTTCCCCATCCCCAGTTCAGGGGATGCTCA
GCATGGAAACTAAAAGCAAAGGAGGAAAGGACAGACTACAAATCATAGCTATCCCTCTCT
CTCAGCCTCAGAAGATCTCCATTGCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved