Macaca_mulatta Locus Mono:75:SNORA33
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:75:SNORA33
Macaca_mulatta
Mono:75:SNORA33
4
SNORA33
1001..1129
2129
TTACATCCTGGGGGTGGAGCTAACTTGACTATGGTGGATAAGGTTTTTGATGTGCTGCT
GGATTCGGTTTGCCAGTATTTTATTGAGGATTTTTGCATCAATGTTCATCACGGATGTCA
ACCTGAACTTTTTTGTGTGTGGTTCTGCCAGGTTTTGGTATCAGGATGATGCTGGCCTCA
TAAAATGATTTAGGGAGGAGTCCCCCTTTTTTCTATTGTTCGGCATTTCAAAGTTTAATT
GTCCAAAACAGAAATTTGATCATTAGTCTCTTCAAACATTTATCTCCCATCGTTTGCACC
TTAGTGAAGTGCACATGACACAGTCGAAGACACATATTTAGGATCATCCTTGGTTCCTCC
TGATGTATTAGCATGGCTTATTAAATATCTATCAACCTGAGATCAATTCTTCTTGTGTTC
ATCTCAACTATAATCTAAATACTAATCATTTTCTACCTGAACTGATTTAACATCCTTATA
ATTAATCTTTTTTTGTTGGGGGGGCAGCTTGCCCTATAAGATTATTTTATACTCAAAAGA
TAGGCTAATGTTTTAAAAGTAACATTTGATGATCTACTACTCTATTCTCTGTTCCCACCT
TCACTCCTAACATCGGCACACACTCTTCAGTGGCTTAACATCACTCTGAAAATATAACTA
AGTTCCTGGCCCTACTCTATAAATCTCCCTGTGATCTAGCTCCTCCCTGCTTCTCGAGTC
CTGAATCTACAAGGAAAAAAATCTTAAAAATACTGTTATACATTCACCCCTAGAAACACC
AGACATTCAGATAACTCAATTCTTCCACATACCCACTAATCTAATCAAGCTCTGAATTTC
CTCTATATTCCAGTCTATATACTTCTCACATCTCTTCTCAATTCCAGAAAATCTTCTACA
ATGTCATGTGTAATTTAACGACCATGAGCAGCAAAATATCCTATTTTTTTCAACCTCTTC
TCTCAAAGCTTTCCTTAATTCATTGTACTATAAAACAAAACAAGCTAGCCAATGAATCTG
CTTACCTAAACATGTTTCTGCAGAAATTTTTATTTTAAAAAGCTGGTAATAGCACAGTCA
TTTATGAGCCTTAAGTAAAGTTGTTAAGGTCTCTGAAAATGGCTATAACAAATTAAAAAC
ATAATTATAATAAAAATTAGAAGCCTGGCTTCTCCCTGAGGGCAGTGTTTTCCCTGCAGC
CCTCTAGGGTAGTATAACATATTGTGGTGATTGTTAGGCTGGGAGATGCTTTTGTTCCTC
TTTACTATTTTAATACAATTCTACAATTTGTCTCCTTAAAATATAACTTTGAATCTCAGT
TCCATGGATTTTATCACCTACTACTCTTCATTTGCTATTGTCATCTTCAGATCCCAGGTA
TTCAACCACATGTTTTCCAAGGCATCTGTTCCCGGCTCCATATCCCTCTCTCCACACTAC
TTCAGTCTTAATTCTGGTGATTTCAGTATACGTGTACATAATCATGCATAACTCTCAGGC
CCTTCATCTCTTTAATTTACCTTCCAATGATCTTCCCCTGCATTCTGCCTTACCTACACA
CTCACATGATCTTGCCCCAGGACTTACTATTAACAATAAATGTAACACTGCATAATTACA
TTGCATGCATTTCACTTTTTGATCATCGTTACTGTCTATCCTTTCAACTCACTTTCTCTA
TTATTCCACTCCTCCAAACTATGAATTCTACTAATTTTTTTCCCTGTCACTGAGATATTT
GATATTTTCTTCCTGCTTCTAAACAAGTCTAAATATTATGGTCAATTATTATAATCTTTT
TTTTTTTTTAACACATATACTCCCTGGCTTGTCTCTAGCTTTGTTGTAGTCACCTAATAA
AATCAAATCCTGTTTAATCCAACTTTATAACTTCTCTGCACTTGAAATTTGTACAACATA
AAATGAAAGGAGAAAAATGCCCAACTAATTGATTACTTCATTATAAATTAATAATTATAG
ACCTAAATTAAGCCTTAGTGATTTCTGCCAGTTTTGTCAAAATTCCCTACATGCATTTAC
TCTTAAGCTATCTAAGATGACAATTTCACAGCTTCTTAGCTCTCCTCAAACCTTCAACAT
CACCCATTTCATTTTCATTCCCAGATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved