Macaca_mulatta Locus Poly:17:SNORD65
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Poly:17:SNORD65
Macaca_mulatta
Poly:17:SNORD65
16
SNORD49, SNORD49, SNORD65
1001..1072, 1517..1587, 2694..2766
3766
AAGACGTCAGATCTTTCCCTAAAGGTCGTGCTGAAGGAGTAATGAGGGTGGCCAGTGCG
CAGGGGTTTGAGAGGCCCCGTGGATATGGTGCTGTGGGGAAAGTATTTGGCGATGCTCAA
TAGTTCAGGAGAAGATACTAGGATGAATGGTTGCTGTGTGCCACGGTTCTATAGGCTTTC
ACGTGTGTTATCTTATGTGATCTTCCGGGGCGCCGGTGTCTCCGTCTTCTGGATGACCAA
TCGGAAGCTCACAGAGAATAAGTAATTGGCCCTAAACCACCCACCTAAGGCGTGGCAGAG
GCGGGGCCCAAACGCGCGCTCCAGCCCTCGCGCAGGCGCCTTGGAACTCGCCCGCGTGTT
GTGACCCAGAATTCCTGGGGCTGTGGAAGAGACCATAGGCTCAACAGGAGGGGGAGCCCT
GGGTTGCGCGCCGGTCTGCATCGCTACTTGACGGAAAGTTCCCATGAGTCTTTGCCAGCG
TCCCCCTCCTTTTGTGACGAATAGGATATCCCGACTCCTTAAGGGCCTGGAGCGCATAAG
TTGTGACCTTTTCATTCCCGTTGTTATGGAGGTAAGGTCTCCGCGAATCTGGGGGTGGTA
GCTGGGGGCAAAAGCAAATAAAGAGCTCGAGCTTCTGTGGTCTCTGGGGAGATGTTCCCG
GGAAGCCTGGCTAGAGGGCAGAGGGCAGCTGTTGAGATGGCGTGGCTCCCCGCCTCCTGC
GCTCGCGTGGCCTTCGGCCCGGTGTTGGACAGCCTGGCAGGGCAGCGGGGGGCTGAATCC
GGCTGCCGTGGATGAGGCTCATGGATCACCCTTTTGTGGTAGGGCCACATCTGCCAGAGC
CTGGAGTCTGCGAAGGCCGGGACCCGGTTCTCCGGCCCGCCGTGGGGAGTGTGCAAACCC
GAGAGAGCTGGGTAAGTTGGTGTCGGCTTGCAGTTTGGGGTACCCCGAGGGCGGTGTACG
TCGGTAAGATTTTAACGGGATTACTGGAAGACTTACTCGACTGCCCTGATGATACTTGTA
ATAGGAAGTGCCGTCAGAAGCGATAACTGACGACGTTTAACGTCTATCTGACCGCAGTCG
CTGAAACCTCTACAACTTAGTTGACCATAACTGCCAGAACCTGCCCTGAATTCCTGTCCT
TCACTCCCTCTTTCAGATTGCCTGCCCACCGCAGAGTGCTGAAGACGGGGTAGCCATGAG
GTAAGAGGCCCTCTGGGGTAGGGTTTAACATGGAACGTAGTTTTGTCATCTTGAATGCAC
GGAAATTGGCGTTTTGACAGTTTTCTACGTTTAGGTGTTTTATACACTTGAGGGTAATGT
GTCAAATCATTGCATATGATGGAACTGAAATAGAAACTGGAGATGGCTGCCCACATTCCT
AACCTAGAACTGCATTTAAAGCAAAGTGATAGGCAGAAGCAAACTCCTTCGTTAAGAAAT
GTCTCCAGTGGCAGCGTTAGATTTTTCAGGTAGGGTCTAGATCTCGAGCAGTACTGGAGA
GTTGTGAGGTGCTTGACTGCTCTGATGAAATCACTAATAGGAAGTGCCGTCAGAAGCGAT
AACTGACGAAAACTACTCCTGTCTGATTGCAGTTAAGTCTTCACCATTTGCTGGTTCCCA
GGAGTAAAACTTGTCTGAACGGTGACCTAATTGCTATATTCACCTAGGTTGCAAATTCGT
GAAGATATCAGCAGCATGTTTGGCAGCTGAGTATTGGAGCAAGGAGCCTGCCACAAGGTA
AGCCTTGCTCTATGGGGAGGCTAGTGGCTGACCATGCCTAGCTGTCAGGTGGAATGTTGG
CAATTGAATTTGGTTAACCTGATACCTTGTAACAGTGTAGCCTATCCCAGAGATACCGAT
TTTGGTTTCTGGTGGCATTGGAGCCAGGGTGGAATAGCTAGAAAGAGGGGCTACTCTATT
TACCTCTTGGCTGTTTAGTCTTGGGCAAATTACCTGTCTGCTGAGATGTAGTTTTCCTCA
GATATGAAAAGGAAAAGTAAGCTCTGTGAAGTTTAAAGTGATGTGACTGAAATGTAGATT
GCAACTCCCTGAGGCTGGCTGGGCACTGTGGCCTATAATCCCATCTATAATCCCATCACT
TTGGGAGGCTGAGGTGGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCTGGT
CAACATGGTGAAACCCCATCTCTACCAAAAATTAACCGGGTGTGGTGGCGTGTACTTGTA
ATCCCAGCTGCTTGGGGGGCTGAGCCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTG
TAGTGAGTTGAGATTGTGCTACTGCACTCCAGCCTGGGCAACAGCGAGACTCCATCCCCA
AAAAAAAAAAAAAAATTACAACTCCCTGAGAAGCTAATAAGATTTGTAGTCCTCAATAAT
TTACAAAAATTACCTCTAATAAGGTCTTAAGGGGCTTTTGTTAGGATGGACTTAAATTTG
TAAAGTCATTAATTGACGCTGTCATCAGAAATGCCTCTCCTGCTCTGCAGTCTCTAAGAT
GTATGCACCTTCTCCATTCCCCCAGGTTTTGAGAACAGAGTGCCGTTTTAGAGCTGGCGG
CAGCATCTTAGCCCAAAAGAAGGTAAGCCTTGAGCTGGCTAATGACCCCCTCAACCCAAT
AGTGGAATGAATAAACAGCTGATCTTCTTAAAACTCGCTTGAAAAAAAGATATCAAATGA
TGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGAACCTACGGTTT
TCTGAAGATATCTGTTACCCTGCGATTGACTGTCAGTTGGTGCAGAAAGTGAGATTGAAA
TGTAGTTTCTTTGCAGGTTATATTCCCAGAGGATGTCAATCCCAAGGACCAGTAGCTGCC
GTCAGTTTGGATTATGAAAACTTTAACCAGCATCAACATTGGGTGTAGAAACATGATTGC
TTTGTGTATCAGAGGACATGCTCAGCAGATCCAAGAGATATATTTGGCAACTTTTTCTAG
AAAAGGCACATTGGGTATCATTCATTACATTCTTGAGTTTTTTTGGGTTTTTTTTTTTTT
TTTTTTTTTTTTTGAAACAGTCTTGCTGTGTTGCCCAGGCTGGAATGTGGTGGCACAATC
ACAGCTCATTGCAGCCTCAATCACCCAGGCCTAAGCAATCCTCCTGCCTTGTAGCTGGGA
CTATAGCTCACAGCACATCTGGCTAAAATTTTTTTTTTGTTGAGGTGGATTCACTGTGTT
ACCCAGGCTGGTCTCAAGCTCCTGGGCTCAGATGGTCCTGCCTCAGCTTCCAAAGGCATA
GGCCACATTGTAGCTTTGTCCCTTGCCATCCTGCCCAACGGGGTGCTGTACCTTTTAATG
AATTGACTTTCATAAATTGGTTATGTTGGTGGGCAAGTTCTTTAAGCTGGAAATTGTAAA
TTCTTCCTGAAATGTTTTTTCATGCAGTTACCATGAACTAAATACTACAATAAAGGATGG
TCTTGGGTATCGATTCTTAAAAATGTGTATTTGAAGAAAAAGTAAATTTTGCCTACTATT
GTCAGATATTAGCAGTCCAGATATTTGCTCTAGCTTGTAAACTTCCCTGTGGTCTGCCTA
AGCTCTTAACCCCCTATTCTACAGCTTTAGACTGAAGGCAGAAATTCAAAGCATTTCGGC
CCCTGCTGCTCTGTGTTCCTTGGTGTGCCCTTCTTCCAGCTCCTGCAGCACTGCACCATT
CCTAACCACAACCTTAACAGCACGCAGGGCCCATACTCTAGGCCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved