Macaca_mulatta Locus Mono:176:SNORA12
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:176:SNORA12
Macaca_mulatta
Mono:176:SNORA12
13
SNORA12
1001..1148
2148
TAAGATAAAGTAGTAATTTATCATATAAATGATATGGGGTAGTGGGGGACACTTTACCC
TCCTATTCAACTCTATGCTATCCAGTGATGAAAAGAAACTTCCTCAATAAATTTCACACA
GAAAATCTGAACTACAGACAATTTTGGACACAATTTTTTAGGCTACAAAAGCAGTATACT
TAAACCATACCTGTTCAGTTTCTGATTTTGTCTGTCTTTTTCTTGCTCATATTTAGTCTT
CAATCCTTTGAATGTCTGAACATATTCAATCGATTCAAGTGCTTTATAAAAGTTTTCAAC
TATATGTGCAGTAAGAGACTTGATATCTTCCTGTACAAGCACAAAATTTACATTTAAAAT
ATAATACAATGCTTATTAGAAGAAAAACTTTAAAATTTTGTTTTGTAGTTCTAAAGCTGA
TCAAAAAAGGTTTTTCAAAATCACCTTCCAAAATGTAATGTCCTGGTTTCTTTACACATG
AGTCAGGACTGCACAGAAAACTTGAAAAAAAAGGAGAAGCAATTTACTGGAGCCCTTTTG
TAGGACTATAAAGAACATTCGAAAAGTAAATAGATTTATTTTACATCTTCTGTTTATTTT
TTGCATTTTATATATCTATCTATATATATAAAATATATATATAGCACCTTACAACTTTAC
ATACAATTTCATTTGATCTTCGCAACAATTCTTTGAGATAGGTTTTATTATCCCCATTTT
AGAGAAAAACAAAATTGAGGCTCTAAGAGAGCCTGGATGGTTTGATCCAGAGTGCACAGC
TGGTTAGAGGGCAGATGTTAAAATTATGTTTTCAAAATACTCACGGTGATAGATATCCCA
AATACCCGGACTTGATAATTACACATTCTATGCATGTTAAAATAAATATGTGTACCAAAT
ACATCTGTACAATATTATGTATTAATAAAAGAAAAACGTATTTTTCAACAAACAGGTGTT
ATTTAATGACTTCCTGTTTAACTGCTATCAAAATGGGATATGGCTGTGGTGGTTTTCTTT
CTGGTACATTTGTTAAGTTTTTGAATGAGCCTAACTCCACCACATGTATTACATAGGAGC
TGGCAAAGGCTTGATGACAAAGAGATCTCTCACAAGTCTTTCTCACATCAGAGGCTGGCT
CTCACATATAGAAGAAGAAAAAACAACAGAGGATACATCTTACCTAAGTAATAAGAAGCA
CAGATTTCTCTGACTATATTATACACACAGATCTGATAAACTATCTGGAATTCTACTTGT
CTATTCCTATAGTCTTCCAATAGTATAAGCTTTGTGAAATAAACTACTTGATAGTGATAA
CTTCTAAATTCTAAACCATCACTGCAGATGCATGCATGCCCAGTAGGCTTATTTAAAAAA
AAAAATTAAAGATGTGATTCAGGACTTTATAGATAATACTACATAGTAAGAAACACACAG
GCCATTTCCTAAAAAGATATACCATAATTTGGTTGCATTATGGAATTTAAGTCTTAAAAC
TAGTTCTCCTGTACATCTCAATTAAAAACATGCAAATCGGAAATTAGAAACCTAGGCAAT
GGCTCTGTTATATGTGAAACGAAAAAATACATTAAGTTTTGGGGCACAAGGTACACAAAT
CAACCACTCAAACTTATTTTCAGAAAAACAATTCCATCATAGGCATAGGGACGGGGTTGT
AAACCCTACAATTTGCTTTATCTGTATCTCACCAAAATGTTAAAGGATAAAAATATAAAG
TAAATAAAACAGAAAGTTTTGATTTATTGTAGCAGTACAATGGGAACTAGTGAGCTAGTT
AACCATGTTTCTTCTTTTACAAGGTTAAAGACTTCTATCCTCTTCATCCTTTTAAAAATC
ACATACTTGGCAATTGACCACTTTTAGAAAAACAATCCAGTCAGCCAAATAATCTTCATA
TGAGAACAGCATGTTATCAGTAGATATCTGATTTGTAAGAAATAAAACTAGAGAATGAAT
TTCTAGCTTCGACTTTCTTTTTTCAAATTATTTCCAGCCAGGTGCAGTGGCTCACACCTG
TAATCCAACACTTTGGGAGGCTGAGGTGGGAGGACTGGTTGAGCCTAGGAGTTTGAGACC
AGCCTGGGCAACACAGGGAGACCCCATACCTAAAAAAAAAATTAAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved