Macaca_mulatta Locus Mono:83:SNORA26
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:83:SNORA26
Macaca_mulatta
Mono:83:SNORA26
1
SNORA26
1001..1122
2122
GTAGGGAAACCTGATCTGTATTTGACAAACTGGTGGAAGCTCAGTGCAGACAAGTCTGA
AAGATATAAACTCCAGGGACACGTAGTAATATGGGCAGGGAGGAGAACCACAGTTTTGTG
AGTTTTACCTCCAGGAGCTCAATAAGGGTCATCACAGTGAATACTGGGGGAAAAAAATCC
CCTAATGCATCCCCTCTAGGCTTCTTTGTAGGAGAAGGTATTTACTATGTATGCCCAACT
TCAGTCCTCTCTAGCCCTACTGTCCCACTTACAGGATGAACTTGAGAAGCACATGTGAAG
CTGACAAAAGTTCACTAACAGACTGAAAATGTTTCCCCTCTATGCACACCTTACCACCAC
ATTACTAAAGGTCCACTCACAAAAGTTCCTGTTACCTAATGCATCATGTCTGGCTATCAA
GAAAAAATTATAAGACATATGAAATAGGAAAAAACGGAGCTGGAAGAGACAGAGCAAGCA
TCGAAACTAGACTTGGATGTTGCAGGGATGTTGGAATTGTTAAACCAGAAATTTGAAATA
GTTATGATAAATATCCTAAGAACTCTAATGGACAAAGTAGAAACTATGCAAGAACAGATG
GGCAATGTAAGCAGAAAGACAGAAATTTTAAGAAAGAATGAAAAAAAATGCTACTGATCA
AAAAGACTGTAACGGAAATGAAGAATGCCTTTAATGGGCTTATTAGTAAACTAGACAAAG
CTGAGGAAAGAATATCTGTGCTTGAGAGTATCTCAACAGACACCTACAAAACTGAGAAGC
AAAGGGAAAAAAAGCCTGGAACAAAATATCCAATAACTGTAGGAGAACTACAAAAGCATA
ATGGGAACACCAGAAGAAGAAACAGAAAAGAAGTGAAGAAAAATTTGAAACAATGACAGA
ATTTCTACAAATTAATGTGAGACATCAAACCACAGATGAAGAAAGCTCAGAAAACACCAA
GCAGGATAAATGGCATAAAAATGGCATAGACACCCTTTCCTGTGCCCTTTCAAGGTCGAC
GCAGTGCTTTAAGGGGCTAACACAGAAGGGTTAAGGAAGTCTCCACAAACCCCAGAGAAG
AGATTGTAAAGCTCCTCTTTAGATCCTTTCTGGAGTCACACCTGAGAAAACAAAAACAAA
CAAACAAAAACTCCGACACCTAGGCAAATAATTTTCAAACTACTGAAAATCAAAGATAAA
GAAAAAAATCCTGAGAGAAGCTAGAGGGGGAAAACAACTCAACTTGCCTATAGAGAAACA
AAAATAAAAATTACATCTGACATCTCCTCAGAAATTATGTAAGCAAGAAGAGTGGGCCGG
GCATGGTAGCTCATGCCTGTAATCCCAGCAATTTGGGAGGCTGAGGTAGGAGAATCACAA
GGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGGAACCCTGTCTCTACTACAAATAC
AAAAAATTAGCTGGGCATGGTGGCGGGCACCTGTAATCTCAGCTATTTGGGAGGCTGAGG
CAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATTGCGCCACTGC
ACTCCAGTCCGGGTGACAGAGTGAGACTCCATCTCAAAAAGAAAAGAAAAAAAAGAAAGA
AAAGTGGAATGAAATGATTATTTAAAGTACTGAGAGGCCAGGCACGGTAGCTCAGGCCTG
TAATCCCAGGATTTGGGGAGGTTGAGGTGGGTGAACCACTTGAGGTCAGGAGTTTGAGAC
CAGCCTGGGCAACATGGCAAAACCCTGTCTCTACTAAAAATACAAAAATTAGCAGGTGTG
GTGGCGCACTCCTGTAATAGCAGCTACTCAGGAGGCCGAGGAACAATCGCTCGAACCTGG
GAGGTGGAGTGTTTCAGTGAGCCCAGATGGCTGGCGCCACTGTACTCTAGCCTGAGTGAC
ACAGCAAGGCTGTCTCCAAATAAAATAAAGGACTGACAGAGAAAAAAATACCAACCTAGA
ATTCTGTACAAAACTAAAGACATGTTTACCACATGATCCAACAATGGCACTCCTTGCTAT
TTGCCCAAGGCAGTTGACAACATACATCCACATAAAAACTTGTATACAATGTTTATAGCA
ACTTCACTCATAGTTGCCAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved