Macaca_mulatta Locus Mono:316:SNORD44
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:316:SNORD44
Macaca_mulatta
Mono:316:SNORD44
17
SNORD44
1001..1061
2061
CGTTCAGTTGTCACAATAATCCTACCATGTAGGATTTAATATCTCCACTTTATGGATTA
GAAAATTGAGGATTAGAGAAGTTAAGTTACTGGGCCAAGGACACACAGCACAAAACAGCT
GAACAAATCCAGGCTCTGGTGCAGAACTGTCTTGTGCTAGTGCCCATGTTGTAATCTCTT
CATTTATAAACAGACAGCTGAACACCTGCTGGGCACCAACCAGTGCCCCAGGCAACTGCA
GGTCATGAAGCTGTGGCCTTGCCTCCAAAGACTGCTGGCTAAAGGCTGGAAAGTCTGGCT
AAACCTATTCATGTGCATATCACCTATAAATTAGCATAGTCAATAAATACCAGAAATGTT
ACAGTTGTTTTAACTTTTCAAATGAAATTTGTTTTTATTGTGAATTAATGACTGAGAAGG
CCCTTTTTCCTATATAACATGGATTGTTTTTATTTTGTATAGCATGTAATATTATTATGA
TATTATACACACACGTATCAGCAGACTCTCCCTCTTTTGAATGACAATTACTCAAACTCA
CCCCATTGACAATATCTAACTCTTTGGTGAAGTCTTTCAATAATTGCATTTGTGCTTCTA
TATTCAAGGACTGGAATAAAGTGAAATATTGACCCTGGTCAGCTCTGATTCAGAGAAGAT
TTTGATACACCATTGTATTTCTATTCAACAATTTGTACATTCCATTCTAATTGCATCTGG
CTTACTACAGAGGTTGAGTGTTGAGAAAAAAGAACGGGGCAAGGGAATATGAGAGGGAAG
CTTGTGTTCAGTTAAACATAAGTACAGAAGCTCAACAAACCAGTGAAATTCATTATTTTA
TGGCTCATCAGTTGGTTCAGCTTAAGTCCTTGGATAAACTGCATAGAAAAATATTACCAT
GATAGTTAAATTACTGCCTCTAATAAAGAATGGGTAAGTAGAATCTCAAGTTATATAATT
TTTTTGCTGAAGTAAATCCCAACAATGTAAAAGCCCCCTGACCTGGGTGATGACAAGCAA
ATGGTGCCTGAATGTGAAGGTCATATTTGGCTTTAACTGATTTCAAACAAACAAAAACCA
AAACCAAAAACCCTCCACTACAAATGATGATTTCAGAAAGTTATTTCAGCCCTGGAATCA
CCTGTAATGAGAGCATCATCCTTTTACCTGCATCCTCTTCATCCTTCAAGCTCCCCCACC
AGGAGGCCTGACCCTTCCGGGATTGCACAGCTGCACCCCACAATTCAACACTGAAATCCC
GGGGTTCCTCCGCCACATCCGCAGGGCACATCTGCCCTGAGCAAGTGTTGCCTGCCCCTC
CCTCAAAAGACCTAGGCCCAGTTCCACCTCACAGCTGAAATTAGACATCCAGTGCACTGC
ACACACCCTGGCAGGGACACTTGCTGAAGTTGACACCTGTCTGAGTCAACCCCCACCTTC
CTGAACGGCACATGCACCTCGGTAGGAGACGAAGCGAAATTCGGTGGGAAAATAGTGAAC
TTTAGCCGGAAGGTGAAAATACATTTCTTTTCTGTACATTTAGAATTAATGAATCCTATA
GACCTGTGGAAACTGCTTGTAAACATCTGATTTTTCCATTAAAATATGATTAAAATAAAT
GGCACAGAGAAGCTTTAGTTATTTTTACAACAGAACCCCTCCCCCCCCGCAGTAGAATAT
TTATTCCGTATATTTTTAAGAGGGCTTGGGGGGCATTAAATTATGCTTTGATTGTATTCC
ATCAATGAAAATATAAGACACAAACATCTTATTTCTTATAAGAAACAAATAAGTACTTAT
TAACTGTGTTTGCATTCATGGGACACACAAATGGTCTCAGGCTGAGCTTATCTAGTAAAG
AAAATTAAAATTAGTGTTTTGACTTCTATTCATTGTAAAGTAGATACCAGCCTAAAGATT
CCTAATCAGTTGCAAAATACCTATCATGAAGGAATATGCAATGCAGAATGAAATCGCTGT
CCTCAAGAGAAAGTTCTGAGAATTATTTTAATCTACATAAGGGCAAATTTGCCTCCCATC
ACATTTTGTAGTAAAATCCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved