Macaca_mulatta Locus Mono:77:SNORA2
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:77:SNORA2
Macaca_mulatta
Mono:77:SNORA2
4
SNORA2
1001..1135
2135
AGGCGTGAGCCACCATGCCTGGCCATGGTTGGTTTTTTTGAGACCACTTTATATTTAGG
CCAAACATACGTGTGTGGTGGGGGTGGAGAGGATGACAAGAAGTAGAATGAAGGAGTGAT
GTTTCATTTTGCCAGACTTTAATTGTTACATTGCATGGAATACTGCTGGAAAAAAAATAA
CCTGCAACTTATAATTTGATCCTAGAGTTACCAGCTAGTAACACTTTCTTTACACCCTTT
CTTATTCCGTAAGTTATTAGAAAGCACCAGTTCTAACTCCAAATGATGACATGGTCTTAT
TTTATCTATTAAGCATAAGCTTACAGATTCTAGTGAAGAAAAAACTTTAGGAGGCTACAT
GGTCTATTGGAGAGTGTAGACTTTGCAGTCAGAAGATCCCTATCCGGGCTTCTTTCTTTC
TCAGTAAGACTTGGGACCATAGCAAGGTCTGCAATCTCCTGAGGCTCTGTTTTCTATGGT
TGTGATAACATGGTAAATTATTTTTTTCTAAGCAGTCACACATGGAAATCTTACCTAAAT
TTTATACCATTAACTTTTATTTCACTTACTTATACCATTAACTATTACTTTAGCTATGTT
TAGTATGCATGAGTTAATGAGTGATTAGAGTACTATGAGCAGCACAGGTTTAGAAATGCC
TATTATTTGCCTAAAGTGCAGCCTCTTATGTAGGCAAAATCAAAGTCAAGTAAGACTTTT
ATTTTTTCTTTTTAAAATGCAAAGTAAAATGTGTCTTTAAAACTCTCCCAGGAGGTGAAG
GGAAGCTACCATAACACCAGGTGTTAGGGGCTTGGCTCATGCTTTAATTAGCTACTGTGT
AAAAATGTTCAGGGATTTTCAGTTATCCACAGGCACCCAGAGGCAATGGGTAAAGTTTAA
CTGGAGCTAGAGCCAATTTTTTTCCTCCCTAGAAGGAGTGACAGCAGCAAACAGTGGGAG
AGAAGATGCCAAGTTAGAAGTGCATATAAAGACAGCTTTCCTAGGCCCCGAATCAAGACA
GGTGGTGGTTTGCCATTGTAGCTGTTGGTTTCAAACAAGAGCCAAGATTGATGTCTGTCT
TATGGTCTGTTGGCTAATCCCAATATGAATGGCCAGTTCAGTTGGAAGAAACACAGTCTT
GAAAAAAATAGAAAAAGCAAAGATAAAAAAGAAAAGACAGCTTTCCAAGCTAGGTAACAT
TTCTGTTGTAACATTTGTGGTCAGTGAAATAGAAATCTAGTAATGCTAAAGTAAAACAAA
TTTTCAGCTTAAAAATATTGCCTTTATTCAGAATCATAAGGGTTTAAAAAAAATCTTACC
ATTATGAAAGTTAAAAAAAATATAGCACTCAGTGCAATGAATTACTGCATTTAATATTCA
AACACTTAAGGCACATTTCTCACAATTTACATGTGAGAATTTAGCATGATCCAAACTCAA
ATATCCATTTCTCATATCTTTCAATGTCTGCAGCAGACACTGACTTAGAAACCTTTTTTA
AAGCCATCTCAAAATCCTCCATAGTTGTAGGCATGTGCATTTCTTCTTTGGAAAGATTTC
GGATTTCCTCTGGAGTCAAACCTTCAATGCGCCTTCTCATTGCCATCAAGGACGCATCCC
TAGGTTTTAAGTTAAAAACAACAACAATAACAACAGACAAAGTGTTACTTTGGTTAAATG
AAAACCTGTTAATAGAAACATTTTCAATTGATCTGTTGTAGCATTCTCTAATTATATATA
TGTAGTATTGTGGAGAAGCTTATTGGAATACAAAGCCTGTTGTGTTTTTTAAGCAGTTAA
ATCTGTAATGAAATAGGATGCTAATTTAAATAATTAATACTGAATATAAAGCCCCAGAAA
AAGTAAAAGGGGTATTAAAGCTAGCAATTTGAATTTCATTATAACTATTCAATAAAATGA
AGAATAAGCATCACAGAGTCAGAAGAGAACCTGTTAAGAAAATTAAATATTTTCTCCATG
TAGAGGAAAAGCTAGGTAAGTTCAGTGGTTTCTCCTTTTCTCCTCTATTTGTGTTTAAAA
AAAAAAAAAACTTCAGATTCAAATAGCTCTTTCCTTTTACCAAGTTTTATCCTTAATAGC
AGCCACCATTTATGCAAAGGGATAGCAATACAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved