Macaca_mulatta Locus Mono:17:SNORD73
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:17:SNORD73
Macaca_mulatta
Mono:17:SNORD73
1099214771346
SNORD73
1001..1066
1089
ATGTGACAGTCCAGCTTTTTAAAATTAGAACTTCAGGGATAAATGGATTACGTAAAACC
TGTTAAACCTGACAGTATCTTTTTTCTCCAGACAATGATTGAAGCTCATGTTGATGTCAA
GACTACCGATGGTTACTTGCTTCGTCTGTTCTGTGTTGGTTTTACTAAAAAACGCAACAA
TCAGATACGGAAGACCTCTTATGCTCAGCACCAACAGGTCCGCCAAATCCGGAAGAAGAT
GATGGAAATCATGACCCGAGAGGTGCAGACAAATGACTTGAAAGAAGTGGTCAATAAATT
GTAAGTGTTTCTTTGCTTCCTCACACAACAGAACCTTGAGTATTGATTATTCCTCAGATA
AGGGAAAGCATATGAGACAAGGTAAAGGTCTGTTGAAATCCTGTCTGTGAATATCCCTTT
ACGTGAAAGAGTAAGTACTCAGTAAATATTATTATTTGAGTCAGAGTCTTGCTCTGTTGC
CCAGGTTGGAGTGCAGTGGTGCGATCCTCCTTGGCTCATGGCAACCACTGCTTCCTGGGT
TCAAGCAGTTCTCGAGCCTCAGCCTCCTGAGTAGCTGGGAATACAGGGGACTGCCACCAT
GCCCAGCTAATTTTTTTTTTTTGATTTTTAGTAGAGATGGGGTTTCACTATGTTGGCCAG
GCCGGTCTTGAACTCCTGACTTCAGTTGATCTGCTAGTACTCCGTAAATGGTAATAGTTT
TTTTTTTTTTTTTTTAATGAAGCTGTCTCACAGTAGATGGAGTTGAAGGACAGGAAATGT
TTTTCCCCTACTTGGAAAATAGACTGAATAAGCTGGGTGCAGTGGGATGTGCCTGGAGTC
CTGGCTACTTAGGAGGCTGAGGCGGTAGGATTGTTTGAGGCCAGCCTGGGCAATATAGGA
AGACCCTGTTCCAAAAAATAATAAACATACATATATATATATACACACACAGAGAAAATA
TACTGAACAGACAAAACCTTTCATGATTAATAACACATGGGAATAAGTGATGAAAAAAGT
TTCGGTCCCAGATGATGGCCAGTGATAACTTACATTTTTCTGATGTTTCCATGCAATATA
CAGTTAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved