Macaca_mulatta Locus Mono:33:SNORD56
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:33:SNORD56
Macaca_mulatta
Mono:33:SNORD56
10
SNORD56
1001..1071
2071
AGGGGTTAATACCTCTTAGGGTTGAGGAGTAAGTGAGCGATGACAGTATAGGCCTCAGG
ACAGTGGCTGGTATACAGTAAGTGCTTAATAAATGCTCTATATTATTGTTGTTAAATTGT
CACTGTGAGCTAAGTAAGATTCCACGTGAGTACGATGCCAGCTTCAGAAGCTGAAATAAC
TTCTAGGTGGGCCCCCTATGTCCCCCATTTCACCCATCCCCCCTCCCCATCCCCTAGATC
CCCTCGCTGCTCCCAGCCACCTGCACATGATGTTACGCAGCTTCTCCAAGTTGGCGGGAG
TGAAGTACCAGTAGTTGCGGTCACACCTCTGCACATCCTTCTCGATGCGGTGCAGGTTCA
CCGTGTACAGGTCCAGCAGCTCTGGCTATAGGCCACCGGGGCGGGGGGTAGGGGGAAGAG
ATGAAAAATTACATCTGAGTCCCCACTGGGAAGCAGCAATCCTATCTCCTCCTCCTAAAC
CTCTCCTGTTGTCACTGAAAATACATCTCCTACCTGGACCAGCCAGGTGTTTGATTTTGT
TTTTGTTTTCCGGGAGGGTGTCTTTAATTTGCAGGATGGACATTCTCCCTCAGAGAGTTA
CAACTATAGCTGGAAGTGAACCTCTCCCTGCTGAAAACTGGACAAGGAGAATGAAGAACT
GAACAGAGGTCAAATTCTGGTAACAAACCAGCCTGGCTGCTTGAACAATTAGCTTAATTT
CAAAATGGCTCAATGATATGGCAAGAAAATAAGAAACATTTAAGGACCAAAAACTAACCC
AGAAATGTGAGAAAACACTAAAGCTGGCCTCTGCCTTAAGGAAAGCTAGTCAAGTGGGAA
AATTTAAGCTTAGATTTAATTGTTTTATGCTCCCCCACCCAAGCTGAAGATCTAATAAGA
GACCTTCCTACAGGAAGGTAGGACCCCAAAGAGTCACACTCTCAGCAAGGAAAAACTAGA
AAAACCCACTAATATTTTGGGATCTCAAAACAATTGCCTGTCCACAGTGACAGCAGTATT
TTTCATCCACAGTAGTTCACCTTATGAATGTTGACACTTTGGGTCTGAGTTAAACAGCAA
CGATACCTGACTGCTTATACCTTGATCATAGTCATTAAATTAAATGTAAATGTTATCTCC
CTGGATAATTAAGAGCCACAAATCAGGTTTGTAACTCATGCGGTTTATAACCCAAACTCC
CATTACCTGGGTGGTCTGAAAGATCAGAGAACGTAGCTGTCATCTCAAATTTGTTATTTC
CCTAGTACTAGAAAGAAGCAAAAGAATACCCCTCTCTTGAGGCATCTACCTTCCACCTGG
GTCTTAAATAGTGCAGCAGATAATATCCCAAGAAATATGAGCTCGTGTTCAAAAAAATCA
CAAAACACTCAGAGAAAGAAGGTGCCCAGAGTGACGGTCAGCACAAATACAAGATAACAG
AATCAGAGCCATCAGGGCCTCAGTTGTTAGAGGTATCAGAAACAGATCATAAAATAAGTA
TGTTTACTGTATTTAAAGAAATAAGGCAGGGCGCCAAGGCTCACGCCTGTAATCCCAGCA
CTTCGGGAGGCTGAGGTGGGCAGATCACTTGAGGTTGAGAGTTCAAGACCAGCCTGACCA
ACATGGTGAAAACCCATCTCTATTAAAAACACAAATTTAGCCGGGCATGGGTGTGTGCTT
GTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCGAAGG
TTGCGGTGAGCCAAGATCATGCCATTGCACTCCAGCTTGGGCAATAAGAGAGAAACTCTG
TCTCAAAAAAAAATAAATAAATATATAAATAAATAAATAATAAAAGAAAAGGTTAACAGT
AAGAACAAAAGCAGGTGTGCACTGGTTCACGCCTGTCATCCCAACACTCTGGGAGGTCAC
AGCGGGTAGATCACTTGAGGCCAGTTCAAGACCAGCCTGAGCAACATGGCAAAACCCCGT
CTCTATAAAAAATACAAAAAATGGTCGAGCGTGGCGGCTCACACCTGTAATCCCAGCACT
TCGGTAGGCCGAGACGGGCGGATCACGAGGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved