Macaca_mulatta Locus Mono:38:SNORA32
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:38:SNORA32
Macaca_mulatta
Mono:38:SNORA32
7
SNORA32
1001..1121
2121
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATACCAGAAATGTGAGGTTGGTCCAACACATAAAA
ATTAATCAACATAATAAAGCATATTAGCACAAATCCACATGATCGTCTCAATAGATGCAG
AAAAAGTATTTGACAAATTCCAACATCTTTTCATGATAAAAATTCTCAACAAATTAGAAA
CAGAAAAGAAAATTTCTCAACCTGATAAAGGGCATCCTTGAAAAACCAATAGCTAACATC
ATACTTAACAGGGAAAGACTGAAAGCTTTGCTCCTAAGATCAGGAAGAAGACAAGGATGT
CTACTTCTCACCACTTCTATTCAACATTTTACTGGAGGTTATAGCCAGGGCAAAAAAGAA
TGTTCTAGGCAAGAAGATGAAATAAAATGCATCCATACTGAACAGCAAGAAGTAAAACTA
TCTCTGCTCACAGATGACCTAATGTTATATAGAGAAAACCCTAAATAATGAACACATATA
CGTATTAAAGGTAATAAATTCAGCAAGGTGACAGGATGTAAGTTCAATGCACAAAAATCA
GTTGTATTTGTATACACTGACAATGAAAAATTTGAAAATGAAATGAAAAAAAAACAATTC
CATCAATAATACCAGTAAAAAGAATGAAATATTCAGAAAAAATCTAACTAAAGTGCAAGA
CATATACACTGAAAACCATAAAACATTGTTGAAATGAATTAAAGAAGATCAAAATAAATG
AAAATATATCTAATCTTAATGGACAAATTCAAAGTAATTCCTTTGAATTCAAAGTCATTC
AAATCTAATTCCTTATCTAGATTTTCTTTTGCAAGGATCAACAAACTCATCCTACAATTC
ATATGGAAATTCCTGAAACCCAGACAAGTCAAAATAAGCTTGAAAAACAACAAAGTCTTT
TAGAATGCAGTTTCTCATTTGCTGTGGACATGACCATAAAAAAATTTCCCAGTAGGTTTT
CTATCTGCTACTTTGCTAGCAATCAGCTTATTGGGAACAGTTGATTAACTGTAATAGAAA
TGCAATACAAATACAATGTGAATCACGTGATTTTTCTTTTTTTTCTAATAACTTTCATCA
GTAATCAATGAAATTTTAAAATTCTGCTAGATCTCTTGAATCATGCAAATGTGCTTTGCC
TTTGTATTGTAACCCTTGTGGGATGCTAATAACCAAGCAGTCTGTAGTAGAGTTAACTCG
GGCTGGTTCTAGGACTCATTCATGTTCACTCACTCATTCATGTTCACTCATTCATGTTCA
CTCATTCATGTACAATCATCTCTGGAAATGTAAAATTTACTTTTATATTGTTATGTAGGG
CTGACAGGACAGCTGGATCAGTTTCATTAAAAAGGGCAAACTTGAAGATCTTTTGACTCC
AGCTTTTTAGGGGATCTAAAGTGACCTTGATGGACAGTGGAAGAAATCACAACATGGAAT
TCCTTGAATAAAAATTTATTGACTTTAAATAATTTTGTCTAATGCTACATATACACAATT
TAAAAAAACCTCTTTACACTGTTTCTAGAAAGTCAGCATGTATTTCTGGCTCGAAGTTTC
TCTAGTGTTTTCTGTGGAAGGAATAAAAATTTAGTAGTTTCAAAAAAAAAAAAAAAGAAC
AAAGTGAGAGGAATCACTTTCTGATTTCCAAATTTACTACAATGCTACAGTAATCAAGAC
AGTGTGATACTGGTATAAGACAGTCAAATAGATCAGTGAAACAGAACTGAGAGTCCAGGA
ATAAGCCCATAGATCTATGGCCAAGTAACTTTCAACAAGAGTGCCAAGACCATTCAATAA
GAAAAGAATAATTTTCTCAAGAAATGGTGCTAAAACTACATATCCACATACAAAGGAATG
AAGTTGGACCCCACTTTATACCATATATAAAAATTAATGCAAAATGAATCAAGGCCTAAA
TGTAAGAGCTATAACTATAAAATCCTAGAAAAAAAGAAAAGATATATATCTGTGCAACTT
TGAGTTAATTAAACAAAAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved