Macaca_mulatta Locus Mono:262:SNORD36
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:262:SNORD36
Macaca_mulatta
Mono:262:SNORD36
3
SNORD36
1001..1080
2080
TTTTTATTTAAAATATAATAATAATTTGTCAAAACTCATTGAAACTTTCATTTGAGTAT
ATTTTCTAATTTATAAACCATGCCTCAATAAACTCAACTGAAAAAAATAGGAAGTGGTTG
CTAGGGAGAGGGAATAGATATGAAAAAGGTACACTCATGAGCAAAGGCACCTAGGGAGGA
ACACATAGGACATCTGTGGGAGTAGTGGCAAGTTCCATTCAATTGGAACAGAAGACAAAT
GAACAGAAATTGTTGCAACACAAATTAGAACATTAAATAGAGTTAGAACAGTGAAGGTCA
TAAACATCAGAATAAACATCTCAAACATTATTTGTAAACTGATAAGAATGAGTCAATTTT
TATTTGCCTTTCTCTGTTTTTCCTCACCTTTCCTCTATTCTCTTTCCTCCTTTCTTTTCT
TTTTTTTTTTTTTTTTAAACATTTGGAGTAACATCCTCAGACAAGTAGATAGACAAGCCT
CCAGCAAACAATAGGAGGAAGAATGCCATGATTCCTCCTTAAATTGTAGAAGCTCTTTGG
CCTCTGCTGTGCATAATCTGCCTACCCATCAAATCACAAAATTTGTTTGTTTATATAATG
TCATCCTTTCTCACAACTTTTAGCAACAGAGTTCTTAAGCTCTCAAGGGAACTGTCTATT
TGAGGAACCGTAAGGATTGGTCAAATATACTGGAATACTGCAAAGGCTAAAAAATGAGAT
TCTTTATAAGACTATGAATCAAGTGAACTAAATATTAGGCAAGACAACGTTGTTGTATCC
AGATGGCTAATTTGCATGGCTCTGTTTAACCCTTGATATTTTTCCACACACATTTCCTTA
TTATAAAGACTGTTTTAAGAAATACATTACCTCCTTTGGAGAGAAAAACACCTTGCAGAA
ATCAGGCTGCCGGATTTGAGTCTTGCTATTCACGTTTCTAAAATGAAGGCAAAAAGAGGT
TTAAAAGATTTGGGACTTTGAAAAGGCAGTAGCTACTTTAGTAGCCTACAATGAATTGGT
CTTTTCTTAGATTAACAAGCTAGTGAAGTTTTAAATACGAGCTTTTTAAAATAGAGTCTT
GCTTGAAAAGTTCAAAATCAAAATTCAGATAGTGTTCTCAATATCACTATTATTTCAAAG
TTAAATTAATGTGTGTAATTAAGTACCTTTCAAAGGTTTTATAGAAAACAAAACATTTAG
GTGATATGAAGTTATAAAAATGTGTTAATATATGATATAAAAATACGATATCAATATAGC
AATATGACTGTTGTTACTTTTAATTTCCCATCAAGTAGGGATCCACAATCTTTGCCTTCA
GTCTAAACACTACCAAAATTGTTTTCTATCTGTACATGGAACTCCTAAAAATTATCTCTA
TACTTAACTGTTTCAGCACATTCTTGTAATCTCATTGTATCGCACTTGTAAGTGTAGAAT
AAGATGTCTAAAAAGTAGCACAGAAGCATTATTTGGAGTAGAGGTGAAGCGGTGTCAATA
TTTGGTCATATCTTGCACCCTCTCTGAAATCCTCTCTTCTGTGAACTCACACAATCATTC
CATGCCCATCCTGGTTGCTTTCCCCTAGGCAACTAAAGAAAAAAAGAAAGTCAGTAAGGA
ACAGAATAGAACATTTAATATTTGGAAATTATAGAGATCCACAAACCAAAGGAATTTGTT
ATTTATATTCTGTCAACATTCAGGCTGAAGCCAAAGAAATTGAGACAGATTTGAATTCTA
CTTCGCTGAGTGTTGCTTAGGAAAGTCACAAACTCTCTTAACCTCAGTTGTATCACCTAT
GTAAATGATGTCTCAGCTAACTATGAGAGCACTTTGTAGTATTAAACCATATTACAGACA
GCTACCTGGTAACATCAGCATTAACAAAAGGCATGAATATGTGGAGACTTGAATTTGAGT
CCTGACAGCACAATGTGTTAATTTTATGAGTTTGGTCTGTTTTCTAAATTTCTCTAAGCC
TCAGTTTTCTAATCACTAAATTAATGATTGTATTTACTTCATAGAATAGTTGTGAAGATT
AAGTGATAATCAATTTAAGGTAGCATGCAAAGTAGCTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved