Macaca_mulatta Locus Mono:326:SNORA3
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:326:SNORA3
Macaca_mulatta
Mono:326:SNORA3
5
SNORA3
1001..1129
2129
AGCCTGTTTCAGTAACTGGTTAAAACTTCAGATTGTCTCCTTTGAGACAGGGTATGTTC
TGTGTGTGGAAAGACAGGTAAAATACATGTTTAGTGATCAGAATAGTAGATTCCTGCAGA
TACTAAATTTTTCTGGCCACACAGCTATATTTCCATGCTTCTCTTCCAATTAGGTATATG
GGTTAGGTGTGCTAATTCGGTTCTAACCAGTGGAATGTGAGTAGAAGTGATGTGCTCCTA
TTCCAGCTCTGGCCCATGGAAACATCACATGAGCAATCCAGTATATTACCACTCCCTACC
AACTTGAGGCAGATGAGCAAATTTGCACTGGAAGCTATGTGTTAAAGATGGCAAAGCCAC
AAGGTAGGACTCCTGGATTCCTGAATCTTCACTTAGAGGATACTTGCTTCCCAATTAGAG
ACACTTGTGCTAGAGTTTCCTGACTCTTCACTTGGAGGATACTTGCTTGCCAATTAGAGA
CACTTGTGCTGCAGTTCATATGCATTCTTTTGTGTTAGGCCACTGAGATTTGAGAGCATG
TCCGAATGTAGACCTGTCCCTCCTTCTGCAGATGCAATCGTTCATTACCTAATTCTGATT
TTTATACCACAGGATGTGTATAAAAATCAGGCTAGCCAAAGTATCCTATCATTCAGCCAT
AGTGATTAGTTCAGGAATGGGCAGATTAACAAAACTGAAGTTAATCAGAGATAGTTTCAC
CATTTGGGCTAGCACTATCGAGAAAAAGGCACCTGCTTTTGAAATAATAATTAAAAAAAA
AAAAAAAACAAGCTACATCTGGCCTTTGGTCATCATGTAGAGTGAACCTGCCTAAGAATG
AAATCATTACAGGAAAACAGGCAGTCTCAATGATACTGCAGAAGGGGAAGATATCCCATG
AATTGAGAAATATTTCCTGGGTTTCTACTCAAGATTGAAATTCCAAGAGGTAAGGCATAG
ATACTGCCAGGAAGACCTGGGAATTCAAAAAAAGGGAGCTCTCTGAGACTAGGGTCACAT
CCTAACAGCTCACAGCTCTTCTCTAGTGTGCTGGAGTCCTCAGAATCTGCTGGTCTTGAT
TCACTGATGGGGGCAACCAGTGTCCCCTTAGTGTCCGGGCAGAAACATACTGTACCTTGG
TTTTAGAAAGTAGGTTGGCAGGCATCTTTCCTCATTCCCATCAAGGAGTTGGCACCTGCC
ACAATATATTGTAAATCCTTTTCTCTGTTCTTCTAGAGCTACTACAAAGTGCTGGAGAAG
GAAAAGCTCCTAAAGCAGCCTGTCATCCTGAAGGCCAAATTATGTAGCAGAAGAACTTGA
GAAAAGATTAAGGCGGTGGTGGGGAGGACCTGTGTCCTGGTGGCTTGAAGCCACAGGGAA
AGAGTTTCACTAAATGCCAACAAATGCTAAAAAATAAACAAAACAGGGAGCCAGTGGCTT
GTGCTCTGCTTTCCACCTGAAAGTTTGCCCAACATAAGCAATTATAATCAAGTAGAAATT
GAAGCATATGTTTAGGCAGAGAGGACCAGGTGACACTGATAACCAGTATCCTCCCAGCAA
CTGCCTTAATTTGGCTTTCATGAGTTTTCACCCATATTATTGCAATAGTCAATCTCCCTG
CCACTGATCCTATTATACTCTACTTTATCTGCCACATTGACACCTGAGTTACTTCTCGAC
CTTGTAAAAACAATTTATTTCTGAGTGCAACAGCAATACATGTTTGTTGTAGGATACTAA
GAAAATACAAAAAAGCACACACACCAGAACATATAATTCTATCAGCTAGAGATATCCACT
GTTGGCATATTAGTACAAACCTTTACACAGTGTTTTCTCTGTATATTTTTAAATGAGAAT
GCCACTGTTGTATTTAGCATGCTTTTAAAAATGTTTTATTTTTGTTTTTCAATCCACCAA
TAAGGTATCCTGGAGCATGCTTTTTTTTTTTTTTTTTTTTTTTTTAAAGTATATGTGAGC
ATTTTCTCATAGAATGAAATGCCCTCTACAATAGTATATATAATTAATATAGCAATTTAC
TTAAGACAGGTGTTGCAAACTGGCAGCCTATAGCCAAATGTGATATATGAACATGTTATA
CTTTGTCATCACAGCATTTCAAAATCATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved