Macaca_mulatta Locus Mono:131:SNORD45
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:131:SNORD45
Macaca_mulatta
Mono:131:SNORD45
2
SNORD45
1001..1079
2079
GTCTGCAAAAAGTCTTTATTTTGCCTTCATTTTTGAAAGATATTTTCTTTTTCAAATTC
TAGCATGTAGAATTCTACGTTGACAGTTTTGTTTTTTCTTTCAGTATTTAAAAGCACTGT
TCAATTTTGTTTCAATTTGCATAATTTCTGATAAGCTTCTGTCCTCCGTTAATTTTATCC
TTTTTCTTTCCCACATAATTAATATGTCTTTTTCCTCTGCCTGCTTTTATGATTTTCTTT
TTATCATTGATATTCAGTGATTTGATCATTATGTGAGTTTAAGACCTTACTGAGCTTTAT
GGATCTGTGGGGTTATAATTTCATCAAAGTTGGAAAAATGTTGGCCATTATTTCTACAAT
ATCTAAAATTTCTAAATTTTTCTAAATTTCTAAATTTCTAACATTTTATAGAGAATTTTT
TTTTTCTCTATTCCTCAGAATGTTGGCTATACCTATGTTAGACAAGTTTATATTTTCCCA
CAGATCATAGGGAGGGTCTCTGTTCACTTTTTTCCAGTGTTTTCTCCCTGGATTTTATTT
TGGCCACTTCCTATTGCTATGTTTTCAATTTCATGGACCTCATTTTTCTTTAATGTCTAA
TCTGCCATCAGTTCCATCCATTTAGTCTTTTTAAAAAATGATATTGCATGTCTCTAGAAG
TCCATATTTATAATGACTTTTTTCTTTTTTTTTTAGATGGAGTCTCGTTCTGTTGCCCAG
GCTGGAGTGCAATGGCGCGATCTCCACTCACTGCAGCCTCCGCCTCCTGGTTCAAGCGAT
TCTCCTGCCTCGGCTTCCTGAGTAGCTGGGATTACAGGTGCACGCCCCCATACCTGGCTA
ATTTTTGTATTTTTAGCAGAGAGGGGATTTCACCGTGTTGGTCAGACTGGTTTCGAACTC
CTGACCTCGTGATCTGCCCACCTCGGCCTCCTGAAGTGCTGGGATTACAGGTGTGAGCCA
CCTCACCTGGCCAATGGCTTTTTAAAAATCCTCAGCTAGAGGATTGATGATGAGCTGGCA
TATATTCTGAATCTTAAGTTTATTATTACTACTGTAGCTCTAAAATTACTGTGATACCTA
GAAAACAATAAATTTAAAAATGCTTGACTAAAGGCTTCAAGATGACTGACTAGAAGCATT
TCATTCCTGCCTCTCCCACTTAGAAGAACAAAATAGTGTATAGACAGTGACACTTCAAAT
ACATTACCCAAGAGTATTTGCTGGAATTCAACAGAGAAGTGACAGGAAACACCAAATGTG
GAGAAGGAGAAAGGAGAGACACAGCCCGCTGGTCAGGATCAGCTGGGAGCCAGGAGTGAC
TTCCCAACATAGGTAAGTGAGAGATGGAGCAACCCACATCTCCTCTGTGGAATCTTGCAA
TCGTAGCCACAGGACAACCCTCAACCCTGCCAACCCCTGAAACTAACATAGGCAGCTGCT
GTGAGACCATGGGACAGAACTGCCCCAGGGAGAGAGCTCGAACTGGGTCCCACGCCCTTC
CTGAAAACTAAGCAGCTACAGCAAGGTGCCATTTTCAAACACAGACTTTGGGAAACTGCA
TGCTGTCCTGGGGCCCAGTGGCATCAGGACAGAAGCATTACGGAAATTTGGGCTATCATG
GTTGGGACTGCAGAATGAGCTGAGAATACTCCTATGGCCAGGACTAAGAAGTGAGGCATG
GGCTACAGCTGCTGGTGCCAGGAAGGAAGTACCACTGGAATGGAGACTGGGACGTGAACT
AGGCACAAGTTGCCACTGGGGCTTGGTTGCCAGCTGGGTGGAGGTTCTTGCAGCTGTGGT
GGGGGTGGTGCATAATAGAATAAGTGTGGGCTGCCACTGCCAGGTGTTGGGGGTAAGCCC
TACCAGGACAAATGTATGGGAGGGATGCATGTTCCTCACCCACTGGCCCAGGCTGTGGGC
CACTGAAGATGGCCATCTCCCAAGTCTCAGGCTCACAAAACCTGGGTGGGGACTGAAACT
GGGAAACTGAGGCGGTTTCAGAGGATCACTGTCCCCTGCTTGTCCCTATTAACTCAACCT
CACCTTCTACTGCAAATGGACCCTGCAGATCAGCAGCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved