Macaca_mulatta Locus Mono:74:SNORA18
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:74:SNORA18
Macaca_mulatta
Mono:74:SNORA18
4
SNORA18
1001..1124
2124
AATTATTGTGGTGGGTGTAAAAGAACATCTCATTTGTATTTTAATTGGCATTTCCCTGA
TAGTTAATAATATTGAGCAATTTTCATATCTTTGTTGAACATGTAGACACCCTAGATTGT
GAAATGCTTGCTCAAGTATTTAGTTCATACTTTACTGGATTCTTTGTTGTTTTTATTTAC
TATTATTATTTTTTTTAACAGATGGGGTCTTGTTCGGTTGCTCAGGCTAGACTTCAGTGA
TGTAATCCCAGCTCACTGCAGTCTTAAACTCCTGGGCTTAAGTTGTTCTTTCACCTCAAC
CTCCTGACTAGCTCTGAGAATACAGGTGCAAAACACCGTACATGGCTAATTTTTAAAAAA
TTGTTTTTAAAGATTGGAGTCCAGGCTGATCTTGAACTCCTGGACTCAAGTGATCCTCAC
TTCTCATTCTCTCATGTAACAGGGATTACAGGCATGACATTGTGCAATGGCTCTTTGTCT
TTTCTTTTTCTTTTTTTTTATTATACTTTATGTTCTAGGGTACCTTTTCAATATATTTTG
GATTTGAGCCCTTTCTCTGTTACACATCTCTTTCCACTATGTGGCTTGTGTTTTTACTTT
TTCTAGGAATGGCTTTTAATGAGTACAAAGTTCTTAATATTAATGTGAGATTACTCACAC
ATATATATTTACATATACATATATTCCTTTATGGTCACTGCAACTGGTACAAATGTTTTT
ATGTTTAGGAGTAGTTTACAGCTTTCCACTGACTATTCTTTATTTTGTCATATCAGTTGA
ACCTGAGTAAATGTAAAAATGGGTATAACTATTGCACATGTAATCAAGAGAGCTAAGTTA
CATATGCCTGATATAAAATGTGATCTTTGTAATAATCAGACAATAATAGTTGAATATGGG
GCAAAATATCTTATGAAAATAATTCATTATTGACTGTTTTAGTTCTTACTGGAAATGTTC
AATGTTTTATTCATGTTATTGTGCTAAAAAAATGAGAGTTAGTTGAGGTCTAACATGATA
GGGATTTTTCTGTAGCCACACCATCTGAAAACATCTAGTGTAACTCTGTGATTTTGCTTT
ACTCATAGGAATATTAGAGCTGTGGGGAGGAAGTATAATACCAGAAAGAGTTGCTAAAAG
TATGAAAGGCCAAGTAATACATTTGCTTTTGCCTTTGGTATTGGCATATCCAACACATCT
ATACTCTTATTGCATATGATAACTGAAGAATATGATTTGAACCCATTCATATTTAGGAGG
GGTGTCAGAAATTGAGAAGCAGGCAGACCCATATACTCTAAAAAATGATCCTAAAGTAAA
TTGTTTAAGAAATTAGATTGAAAAGATTCTTTGTATGGGGAATTTTTAAAGTTGGTGTCA
ACATGTCCATATTCAAGTGAAGGTAAGAGAAGCCCAGACCAAAAAAAAAAAAAAAAAAAA
ATTGTGAAATGACAGGATAACTGTGAATTAAGCATCAATTCCTTTATATAGGGCTATCAT
AAAAATAAATCTTGGTTCAATTAGAGGAACTAAGCTGTCCTTGATGAGCAACAGAAAGTA
ATCACAACATGTGAATTTCTTTGGATAAAAAAATGTATTTACTTAAAAAAATGAGAGTAG
TCTTTATATAGCATTGGTAATTGCATTTAAAAAAACTGTATTGTTATTTATTCAAACTTC
TGGACTAGGGAAGTTAAACAGTGTCCTCAGATTGCATGATAGGTTGTTTAAAAATAGAAA
CTATTCTGGCAATTACTTATCTGTGCAAATTAAAATTTTCTATCTATTCTAAAAAAGGCA
GGCTAACCAAATGACAAATAGAAAGAAAATAACTTAAAAAATAATTAAAATATATCCTCA
GATTTAACGTAGATTATTCTTTATTAAAAATTACAATTTAAAACATTGGTATCCCAAATA
TTCGATTATAACATTTTGGGCTCATGAAAAGATTCTCATGGATAAACTTTGTAATAAATA
AAGAGCATAAACTTGAAATTTAAATAAACATATACCAATAAAAATGTCTATTTTATATAA
TTCATGGGTATAATTTATATTTAACATTTTATTTAAGCACTTTAATACAGAATATTACTG
TAAACAAAATATGAACACTTCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved