Macaca_mulatta Locus Mono:109:SNORA40
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:109:SNORA40
Macaca_mulatta
Mono:109:SNORA40
9
SNORA40
1001..1128
2128
GTTTTTCAGTGAGGTCTCTGGTGCTGCTTGGTATTCCTCCAAGAACTTGAGGAGAAAGC
TACGTACATTTCCATGGTTGCTTCTCAGCACCACTTCTTCCTGTACTTTTCCCTTTCCTG
TACATGCAGCCTGTCTGCCAGCCTTGAACTCTGATTTCTGACTACCCGTCTCAGTGAGAT
CGCTCTTCTCTGCGTGGACAGCACATCTCCGCATTATCTCTAGAAAGTGCCTCCAGGCAA
AAGGCTAGAGCTATCAGGAAGCTCACTTTATGTGTTTTCATTCTTTCAAGTATGACAGCC
CTATAGTGCCTGTGTTTCATTTTTATGGTTGTTTATGGTGGAAATGTCATTCTGATGATA
ACAGTTACTCTGTAAGAGAAATGCAAGTTGTTCTTGATAATATTTTACTTTGCATTGTAG
TTATTCTTGTATATGTCTTATCTTTTTTATGAGACCAGAAGCACCCTGAGGGCAGAGTCC
ATGCATTCTTTATCATTGTTTTTTCTCCAGAGCATTCTACGCAGCCTATGTGCTATTTAT
TATAATTATTTAATTTGATTAAATATTTAATAAGTAAATCTTTAGAATAAATAAATAAAA
TGAATAAAACAAGCACTTTATGAACTTTAGGAATAATTTCAAAGGCCACAAAATCCATTA
CACAGACTAGTTTTCTTTGACTCATCAGTTATTTTGTTTTCTGCAGCAGTCACAAGAATA
CCTAAGTTCCTCATACTACCTTCTTCCCCTGCTGATTCACAAATTTATTATAATCAGAAA
GCATGTGAAAAACTGAGAAACAGGAGAAAACAATCACTGACTGCCATTTGGTAATAGTAG
TAATTATTAGGAGTCAATTCGAACATTCCTTTTTATCTTTTGAGTTGCTTTGCTGGTTGT
CATTCTCTATAGCTACTAAAAAGTCCAGCTAGAATTTATTTTCTTGGTCACACAGGCAAA
GATAATGTTTGGAGTTCAGCAGTCAAAAAAACCCTAATGACTGCACTTATGTATGTTTTT
GTTTAACTTGTGGACAAAGACTTATGGATAGGTGCAAAAAATAAGTCCTCTTTTGCAACC
TGGAACTCATTGTTCAGTGTGAGTTTTGATACATGTAAGAAGGGATATTATGATACCTGA
GACAATTAACTAATGGGAGTATTGATAACTAGAGAGGTTGGTTCCAGGCCAGGCTCAGTG
ACTCATGCTTTCAATCCTCACACTTTGGGAGACTGAGGTTGGAGGATTGCTTGAAGCCAA
GAGTTCAAGACCAGCTTGGGCAAGAAAGTAACACCTTATCTCCACGAAAAATTAAAAATT
AGCTGGATATAGGGGCATGTGCCTGTAGTTGCAGCTACTCAGGAAGGGGAGGCTGAGGCA
GGAGGATTGACTCCAGGAGTTGGAGGCTGCACTGAGCTTTGATGGCACCACTTACTCCAG
CCTGGGCAACAAAGACAGACCCTGACTCTTAATTTTAAAAAGGTTGATTCTAGGACTGTA
GAATAGATAGTTTAAAAGCATGGGATATGAGGGAAATCCTCAGCTGCATTAATTTTGTAT
TCCAATTTTATGTTGACTTGATACATAAGATGGCATTTGGTTTTAAAAGCTTTTATCTTG
AGAACATGTTGTCTGGAGTTAAAGGTATCAGCATATTCCACACATCTGTACTATTCTTGA
GTATGATCGCTTAGGGCATCAAATTGAGAACCAGGCAGATCCACCTATACTAAAAATGAC
CCTAAAGTAAGTTGGTTGAAGAAATTAGACGCCAAAGATTCTTGATTTTTCCGTAGGTGA
ATTTTGAAGTCTTCATCAGTATACCCATGTAAAAAGGAGATGATAGAAACCAAAATAAAA
TAATTATGGGTTGACAGGACAACTGGATTAAAATAAGCATCAGTTTCATTAAAAAGGGCT
AACTTGAGGATAAATCTTTTGAAGATAAATTTTGACATCCGTTCTTTAGAGGATCTAAAG
TGACCTTGATGGAGAGTGAAAGAAATCACAACATGGAATTCCTCAAATAAAAATTTATTA
ACTTTAAATACTTTTGCCTAATGTTACACATACACAATTAAAAAAAAAAAACAAAAACAA
AAACAAAAACAAAACCTCTTTACACTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved