Macaca_mulatta Locus Mono:315:SNORD31
snOPY snoRNA Orthological Gene Database
Macaca_mulatta Mono:315:SNORD31
Macaca_mulatta
Mono:315:SNORD31
17
SNORD31
1001..1069
2069
GTGGTATGGCTATAAAAAACAAAGAAAGTAGGGGGTAAGGCTCCATTAATAGAGAAGAG
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTAGAACTGTGATGGAAACAGCATTAACAGGTCCAGTGTCTCAAAATGATAC
CACATTTGAAATGATTATTTTTGATAAGATGCCATTTAGGAGGACCCGGAGCTTTTTAGA
CACTTGAGAGGATGCGTTACAAAAGACATTACAGGCAGAATCTGTGTAGTTCTAGACATG
GGGCCAGGAACAACCCATGGCAATTAGTGGAAACCAAAGTTCAGTTCAAGTTGAGTGCAA
CTTGTTAACCATGTAGAGATCTGAAAATGGCTGCTTTTTTATAGAAATAAAAATGGCAAA
ACATCTCAATCCTCAGAAAGCCATCTCACTAATTATTCCTGAAATCTGTTTTAAATACCT
AGAACAAACTTGCTAAGCTTAGCTTTTCCTTCAACTCACAAAGCAAATTTAATGTTTCCA
GTGGAGATCAGGATGTTCTTCTAGCAGGGAAAATTGCACAAACTACAAGGAAATGATTAA
TACTCAATATCAATCTCTTGCAATGTTCTCATATTTTTTCTCAATATTCAGAAAAATAAA
ATTGCTTCTGTTCTGTTCCTTTAGCCAGGCTGTTCTCTTCAACTCATTAATTTATCTTGG
AAACTCCACTTTTCAAATTTAAAGGCCCCTCATTAGGATGGTGAATATTGATGGGAAAAA
GTAAAATGACTACTTTACCCACAAAAATAAAAACATTTGCTATCCTTTTTTGATAAAGGT
CTTCTAGATTTGCTTCGCCCACTTTAACTTTTTCTACATATCTTAAAATTCAGTGTGCAA
TAATATTTTCAATTTCTCCACATTTTGGACTTCCTTAGCTTATTTCTATTCACATAAATT
CTTTTTTATAAATGTTGATAGGAAATACCATTCTTAATGATATCACCAGTGATGAGATGA
ATACTGCCCCTTTCTGATCAATATGCGTGAAAGATATTTTCTGAGCTGTGAGCTTGAAAA
ATAAAAATAATTTTTAAAAGATATAATAGCTCCTATTTGTTGAGAAAATCTTATTAATAT
AAATTCAGAGATATTCACAGCCAAAAGGAGCATGGGAGATCATAAGGTTATTAAGGTCAT
CTTATGCTTTTGTTATCTGAGGAAATCCTGCAATCGATAACAATGCAATGAGTGAGTTTG
TCCTGTCGTAGATTGTTTTCACAGGGCCTGGGATAGCGTACTTGGTGAATGTCCATAAAC
CGACATTCTCTACTCAAAGGAGCCCTGTTCTTTCAACAGTAATGATGGAGGGATTATAGG
AATCACTCCTGATTATCTTAAGATTTGCTTTTTATTACCCATTCTAGGTTCATCGTGATT
AACTATTTAAGATCATTTAGGTCCCTTGACCTCATTCTCTGAAACTAAGGAGTTGATGCA
AGGAAGTAAGAAAATGAGTCAAAGATTTGGAAGAAGTCCATTTGAAGTTGAGGGTTTTCC
TGATTAACAGTGGAATGGGTCAAAAGAAGATTATTTTGTTGGTTACGTTTTTTTTTGTTT
GTTTGGTTGGTTTTGGTTTTTTGTGTGTTGGGGTGGGAGAAACTAAGGAAATAATTCCAA
AGGAAAGGATTTTGATGGGGTGTTTTTCTCCTGAATTGTATAGTTTTCAGATTTATTTTA
AAGGATTAAAATGGCCATATTTTCTTACCACCAGTCAATGTCTGTTTATTTGATATGAAC
ATATTTAAAAGACCCCCTAGAGAAGTGTATATATAGCATATAATTAGCAAGTCAAAAGAC
TGGAGGTTACCTTTCCTAGAACATCCCTTCCATGTCTATACCTCAGTATACCATGGTTTT
ACCAAGAGGAATGAAGTTTATATCTGGTGCCTTGTTCTGTTCTTTAAGCTCCTGCTAAAT
ACCTCAACTTTGGTGTGTCTCAAATACTTCAAATTTCAGCCCTTTAAATTGACCTTGTGG
TCATTCCATTAACTCCAGCTTCTCCTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved